The chemo-prophylactic efficacy of an ethanol Moringa oleifera leaf extract against hepatocellular carcinoma in rats

Figures & data

Table 1. Chemical composition of Moringa oleifera leaves ethanol extract.

Chemical composition	MOLEE
Moisture Conc. (g/100 g)	10.74 ± 0.05
Fiber Conc. (g/100 g)	11.23 ± 0.16
Fat Conc. (g/100 g)	7.76 ± 0.21
Protein Conc. (g/100 g)	9.38 ± 0.23
Sugar Conc. (g/100 g)	56.33 ± 0.27
Ash Conc. (g/100 g)	4.56 ± 0.13
Energy (kCal)	332.68 ± 0.06
Mg Conc. (mg/100 g)	25.64 ± 0.25
Zn Conc. (mg/100 g)	1.63 ± 0.021
Mn Conc. (mg/100 g)	5.21 ± 0.12
Cu Conc. (mg/100 g)	0.88 ± 0.52
Vitamin C Conc. (mg/100 g)	245.13 ± 0.46
Vitamin A (β- Carotene) Conc. (mg/100 g)	13.48 ± 0.51
Vitamin E Conc. (mg/100 g)	16.80 ± 0.24
Total phenolic content (mg GAE/g)	48.35 ± 0.05
Total flavonoids (mg/g)	35.64 ± 0.07

Table 2. Bio-active compounds of Moringa oleifera ethanol extract.

RT	Compound name	Area %	Molecular formula	Molecular weight
16.35	Caryophyllene	12.48	C15H24	204
16.61	Eugenol	45.15	C10H12O2	164
16.61	Phenol, 2-methoxy-4-(2-propenyl)-	45.15	C10H12O2	164
22.30	Phenol, 2-methoxy-4-(2-propenyl)-acetate	5.06	C12H14O3	206
29.24	Pentadecanoic acid	1.27	C17H34O3	270
30.09	Hexadecanoic acid, 2,3-dihydroxy propyl ester, 14-methyl-, methyl ester	6.87	C19H38O4	330
32.11	trans-13-Octadecanoic acid, methyl ester	4.40	C19H36O2	296
33.34	13-Heptadecyn-1-ol	2.45	C17H32O	252
33.73	9,12,15-Octadecatrienoic acid, 2,3- dihydroxy propyl ester	2.35	C21H36O4	352

Table 3. The bioactive oil of MOLEE.

Component	Ri^a	Ri^b	Identification^c	%
Oxygenated monoterpenes
Linalool	1033	1450	1,2,3	t
α-Terpineol	1123	1608	1,2,3	t
Phenolic compounds
p-Vinylguaiacol	1212	1836	1,2	t
Oxygenated sesquiterpene				0.8
cis-Dihydroagarofuran	1416		1,2	0.2
Eudesm-11-en-4-α,6α-diol	1707		1,2	0.6
Hydrocarbons				90
1-Octadecene	1145		1,2	0.3
n-Hexadecanol	1153		1,2,3	0.7
Nonadecane	1161		1,2	0.6
1-Eicosene	1172		1,2	0.4
n-Octadecanol	1188		1,2,3	0.5
Heneicosane	1191		1,2	1.5
Cyclopentadecanol	2121		1,2,3	1.3
1-Docosene	2440		1,2	0.7
cis-9-Eicosen-1-ol	2566		1,2,3	10.5
Tricosane	2675		1,2,3	15.0
Tetracosane	2689		1,2,3	20.1
Pentacosane	2722		1,2,3	15.5
Hexacosane	2798		1,2,3	10.5
Heptacosane	2826		1,2,3	12.0
Octacosane	2843		1,2,3	1.4
Nonacosane
Triacontane
Others				0.5
Hexenyl propanoate	1167		1,2	0.5
Phenylethyl alcohol	1176		1,2	t
Pseudo Phytol	1188		1,2	t

a Kovats retention index on HP-5 MS column.

b Kovats retention index on HP Innowax.

c 1 = Kovats retention index, 2 = mass spectrum, 3 = co-injection with authentic compound; t = trace, less than 0.1%.

Table 4. Nucleotide sequences of the primers used in RT-PCR

Gene symbol	GenBank accession no.	Primer (5′→3′)
Bcl-2	NM_016993.1	F:	CCCCAGAAGAAACTGAACC
		R:	GCATCTCCTTGTCTACGC
Bcl-xL	XM_017591479.1	F:	CGTGGAAAGCGTAGACAAGG
		R:	CAACAACCATGCCAGGAGAC
β-arrestin-2	NM_012911.1	F:	CCACGTCACCAACAATTCTG
		R:	TTGGTGTCTTCGTGCTTGAG
Bax	NM_017059.2	F:	GTTGCCCTCTTCTACTTTGC
		R:	ATGGTCACTGTCTGCCATG
caspase-3	NM_012922.2	F:	CTGGACTGCGGTATTGAGAC
		R:	CCGGGTGCGGTAGAGTAAGC
GAPDH*	NM_017008.4	F:	TCAAGAAGGTGGTGAAGCAG
		R:	AGGTGGAAGAATGGGAGTTG

*Housekeeping gene

Figure 1. Changes of rat body weight. The data of body weight are presented as the mean ± S.E. (p < 0.05).

Table 5. Effect of MOLEE and DEN on body and liver weights of different groups of rats.

Groups	Final body weight (g)	Liver weight (g)	Relative liver weight
Control	450 ± 37^a	16 ± 2.32^b	0.0355^c
DEN	320 ± 41^c	29 ± 2.54^a	0.0906^a
MOLEE	465 ± 29^a	14 ± 2.54^b	0.0297^c
DEN + MOLEE	425 ± 23^ab	18 ± 1.65^b	0.0423^b

Means within the same column carrying different letters are significantly different (p < 0.05).

Figure 2. Effect of MOLEE on hepatic morphology, histology (HE staining, ×200) and changes of nodule incidence and average number of nodules per nodule-bearing liver in rats. The data are presented as the mean ± S.E. (p < 0.05).

Table 6. Effect of MOLEE and DEN on serum specific liver enzyme activities in rats.

Groups/parameters	ALT (IU/L)	AST (IU/L)	GGT (IU/L)	LDH (IU/L)	ALP (IU/L)
Control	34.5 ± 6.2^c	41.4 ± 5.2^c	59.8 ± 6.93^c	457.5 ± 23.7^c	127.6 ± 14.6^b
DEN	135.8 ± 21.8^a	148.2 ± 11.5^a	99.3 ± 8.81^a	885.41 ± 29.8^a	194.2 ± 17.9^a
MOLEE	32.3 ± 5.1^c	29.1 ± 5.8^d	55.5 ± 7.81^c	348.2 ± 31.9^d	103.2 ± 19.3^c
DEN + MOLEE	90.3 ± 10.6^b	100.5 ± 13.8^b	73.4 ± 6.81^b	561.2 ± 66.8^b	133.4 ± 11.8^b

Means within the same column carrying different letters are significantly different (p < 0.05).

Table 7. Effect of MOLEE and DEN on protein pattern and MDA in rats.

Groups/parameters	Total protein (g/dL)	Albumin (g/dL)	Globulin (g/dL)	A/G ratio	MDA (nmol/g)
Control	8.3 ± 0.7^a	5.2 ± 0.2^a	3.1 ± 0.02	1.76 ± 0.002	66.34 ± 6.78^c
DEN	4.7 ± 0.08^c	1.8 ± 0.03^c	2.9 ± 0.03	0.62 ± 0.001	351.51 ± 24.67^a
MOLEE	8.5 ± 0.3^a	5.4 ± 0.4^a	3.1 ± 0.04	1.74 ± 0.002	38.21 ± 7.83^d
DEN + MOLEE	6.4 ± 0.09^b	3.1 ± 0.1^b	3.3 ± 0.01	0.93 ± 0.003	187.71 ± 18.58^b

Means within the same column carrying different letters are significantly different (p < 0.05).

Figure 3. The content of 8-OHdG in liver DNA. The data are presented as the mean ± S.E. Columns with different letters are significantly different (p < 0.05).

Figure 4. Effect of MOLEE on the level of AFP and CEA in the serum of control and experimental rats. The data were presented as the mean ± S.E. Columns with different letters are significantly different (p < 0.05). AFP and CEA levels are expressed as ng/mL.

Table 8. Effect of MOLEE and DEN on oxidant/antioxidant status in rats.

Groups/parameters	GSH (mg/g)	GPx (IU/g)	CAT (U/mg protein)	SOD (U/mg protein)	GST (U/mg protein)
Control	104.69 ± 13.87^b	52.56 ± 4.27^a	87.33 ± 6.68^a	23.56 ± 4.51^b	31.39 ± 3.91^b
DEN	43.54 ± 5.76^d	31.57 ± 4.43^b	41.47 ± 7.18^c	11.36 ± 2.37^c	13.71 ± 3.42^d
MOLEE	121.35 ± 17.62^a	53.92 ± 7.92^a	85.88 ± 9.09^a	39.95 ± 9.99^a	53.47 ± 8.32^a
DEN + MOLEE	79.87 ± 7.87^c	48.88 ± 5.73^a	57.89 ± 5.27^b	21.67 ± 7.80^b	23.59 ± 4.87^c

Means within the same column carrying different letters are significantly different (p < 0.05).

Figure 5. Effect of MOLEE and DEN on the mRNA levels of Bcl-2, Bcl-XL, Bax, caspase-3 and β-arrestin. The mRNA levels were quantified with GAPDH as an internal control. The data were presented as the mean ± S.E. Columns with different letters are significantly different (P < 0.05).