Sauropus brevipes ethanol extract negatively regulates inflammatory responses in vivo and in vitro by targeting Src, Syk and IRAK1

Figures & data

Table 1. Sequences of PCR primers used in this study.

Targets	Direction	Sequences (5′ to 3′)
iNOS	Forward	GGAGCCTTTAGACCTCAACAGA
	Reverse	TGAACGAGGAGGGTGGTG
COX-2	Forward	CACTACATCCTGACCCACTT
	Reverse	ATGCTCCTGCTTGAGTATGT
TNF-α	Forward	GCCTCTTCTCATTCCTGCTTG
	Reverse	CTGATGAGAGGGAGGCCATT
GAPDH	Forward	CAATGAATACGGCTACAGCAAC
	Reverse	AGGGAGATGCTCAGTGTTGG

Figure 1. Suppressive activity of Sb-EE against NO production in RAW264.7 cells. (A) To examine the effect of Sb-EE on NO release, Sb-EE pre-treated-RAW264.7 cells were stimulated with LPS (1 µg/mL) for 24 h, and NO levels in supernatant were assessed by NO assay. (B, C) To test the cytotoxicity of Sb-EE, RAW264.7 cells (B) and HEK 293T cells (C) were dose-dependently treated with Sb-EE for 24 h, and then MTT assay was performed. (D) Active phytochemical elements in Sb-EE were assessed by HPLC. The profiles of Sb-EE were compared with standard profiles containing quercetin, luteolin and kaempferol. All data are presented as the mean ± SD of experiments. ^##p < 0.01 compared to the normal group, and **p < 0.01 compared to the LPS-alone treatment group. Rt (min) (area).

Figure 3. Inhibitory effect of Sb-EE on NF-κB signalling enzymes. (A, B) RAW264.7 cells were treated with LPS (1 µg/mL) for the indicated time in the presence or absence of Sb-EE (200 μg/mL). The levels of phospho- and total-IκBα (A), Src, Syk, p85 and β-actin (B) were determined by immunoblotting using whole lysates. (C) RAW264.7 cells were pre-treated with Sb-EE in a dose-dependent manner, and were thereafter triggered with LPS for 3 min. Then, p-Src, Src and β-actin levels were detected by immunoblotting. (D) To examine the direct effects of Sb-EE on Src and Syk activity, an in vitro kinase assay was performed with purified Src and Syk. ^##p < 0.01 compared to the normal group, and *p < 0.05 and **p < 0.01 compared to the control group (LPS alone group in (A–C)).

Figure 5. Anti-inflammatory ability of Sb-EE in LPS-induced peritonitis and HCl/EtOH-triggered gastritis mice. (A, B) Sb-EE (200 mg/kg) was orally injected into C57BL/6 mice daily for five days. Peritonitis was induced by peritoneal injection of LPS (10 µg/kg) for one day. NO assay was performed using peritoneal macrophages (A). Immunoblotting assay was performed with whole lysates obtained from peritoneal exudates. Phospho- or total-forms of ERK, p38, Src, Syk and β-actin were detected using specific antibodies (B). (C) Sb-EE (200 mg/kg) or ranitidine (40 mg/kg) was orally administered in ICR mice twice a day for two days, and then HCl/EtOH was injected for 1 h to induce gastritis. Stomach inflammatory lesions were photographed with a digital camera and then quantified using ImageJ. ^##p < 0.01 compared to the normal group, *p < 0.05 and **p < 0.01 compared to the control group (LPS-alone group in (A, B), and HCl/EtOH alone group in (C)).

Figure 6. Schematic diagram of the anti-inflammatory properties of Sb-EE through inhibition of AP-1 and NF-κB signalling.