Anti-allergic actions of a Chinese patent medicine, huoxiangzhengqi oral liquid, in RBL-2H3 cells and in mice

Figures & data

Table 1. Constituents of HXZQ-OL.

Chinese medicinal materials	Botanical family	Species	Portion used	Amount
Atractylodis Rhizoma	Compositae	Atractylodes lancea (Thunb.) DC.	Rhizome	80 g
Citri Reticulatae Pericarpium	Rutaceae	Citrus reticulata Blanco	Pericarp	80 g
Magnoliae Officinalis Cortex	Magnoliaceae	Magnolia officinalis Rehder & E.H.Wilson	Bark	80 g
Angelicae Dahuricae Radix	Apiaceae	Angelica dahurica (Hoffm.) Benth. & Hook.f. ex Franch. & Sav.	Radix	120 g
Poria	Polyporaceae	Poria cocos (Schw.) Wolf	Sclerotium	120 g
Arecae pericarpium	Arecaceae	Areca catechu L.	Pericarp	120 g
Pinelliae rhizome	Araceae	Pinellia ternata (Thunb.) Ten. ex Breitenb.	Tuber	80 g
Licorice extract	Leguminosae	Glycyrrhiza uralensis Fisch.	Radix and rhizome extract	10 g
Patchouli oil	Lamiaceae	Pogostemon cablin (Blanco) Benth.	Overground extract	0.8 mL
Perilla leaves oil	Lamiaceae	Perilla frutescens (L.) Britton	Leaf extract	0.4 mL

Table 2. Forward and reverse primers sequences of genes.

Gene	Forward primers sequences (5′-3′)	Reverse primers sequences (5′-3′)
IL-4	TCCACGGATGTAACGACAGC	TCATTCACGGTGCAGCTTCT
TNF-α	CATCCGTTCTCTACCCAGCC	AATTCTGAGCCCGGAGTTGG
GAPDH	TGAGATCAACGTGTTCCAGTG	ACCAGATGAAATGTGCCCC

Figure 1. Effects of HXZQ-OL on degranulation (A) and cell viability (B) in IgE/Ag-mediated RBL-2H3 cells. The data were expressed as the mean ± SD values of five independent experiments. *p < 0.05 and **p < 0.01.

Figure 2. HXZQ-OL inhibited the release of proinflammatory mediators: IL-4 (A), TNF-α (B), LTC4 (C) and PGD2 (D) in IgE/Ag-mediated RBL-2H3 cells. IgE-sensitized RBL-2H3 cells were incubated with HXZQ-OL (43.97, 439.7 and 4397 μg/mL) for 30 min, followed by DNP-BSA challenge for 4 h. The amounts of IL-4, TNF-α, LTC4 and PGD2 were determined using ELISA kits following the manufacturers’ instructions. The data were expressed as the mean ± SD values of three independent experiments. *p < 0.05 and **p < 0.01.

Figure 3. HXZQ-OL reduced the levels of IL-4 mRNA (A) and TNF-α mRNA (B) in IgE/Ag-mediated RBL-2H3 cells. IgE-sensitized RBL-2H3 cells were incubated with HXZQ-OL (43.97, 439.7 and 4397 μg/mL) for 30 min, followed by DNP-BSA challenge for 4 h. The gene expression of IL-4 and TNF-α were measured by RT-qPCR. The data were expressed as the mean ± SD values of three independent experiments. *p < 0.05 and **p < 0.01.

Figure 4. HXZQ-OL inhibited the intracellular Ca²⁺ concentration in IgE/Ag-mediated RBL-2H3 cells. IgE-sensitized RBL-2H3 cells were incubated with HXZQ-OL for 30 min, followed by DNP-BSA challenge for 10 min. The intracellular Ca²⁺ concentration was determined using flow cytometry with Fluo 3/AM probe. The data were expressed as the mean ± SD values of three independent experiments. *p < 0.05 and **p < 0.01.

Figure 5. Inhibitory effects of HXZQ-OL on the phosphorylation of FcεRI-induced degranulation signalling cascades (A, B, C) and MAPKs (D) in IgE/Ag-mediated RBL-2H3 cells. IgE-sensitized RBL-2H3 cells were incubated with HXZQ-OL for 30 min, followed by DNP-BSA challenge for 10 min. The expression levels of p-Fyn, p-Lyn, p-Syk, p-PLCγ1, p-PLCγ2, p-PKCδ, p-Gabs, p-PI3K, p-Akt, p-ERK1/2, p-p38 and p-JNK1/2 were normalized to total proteins, respectively. The data were expressed as the mean ± SD values of three independent experiments. *p < 0.05 and **p < 0.01.

Figure 6. Inhibitory effects of HXZQ-OL on the activations of PI3K/NF-κB (A) and eicosanoid cascades (B) in IgE/Ag-mediated RBL-2H3 cells. IgE-sensitized RBL-2H3 cells were preincubated with HXZQ-OL for 30 min, followed by DNP-BSA challenge for 4 h. P-IKKα/β and p-cPLA2 were normalized to total proteins, respectively. The endogenous reference protein used for p-IκB, IκB, 5-LO, COX-2 and cytosolic NF-κB p65 was β-actin whereas for nuclear NF-κB p65 was Lamin B. The data were expressed as the mean ± SD values of three independent experiments. *p < 0.05 and **p < 0.01.

Figure 7. HXZQ-OL inhibited IgE/Ag-mediated PCA in mice. (A) Experimental schedule. (B) Evans blue exudation. BALB/c mice were orally administrated with HXZQ-OL (263.8, 527.6 and 1055 mg/kg/d) or dexamethasone (DEX, 5 mg/kg/d) for seven consecutive days. One hour after the administration with HXZQ-OL, the ears of mice were intradermally injected with 100 ng anti-DNP-IgE on the sixth day. Twenty-four hour after ears sensitisation with IgE, mice were intravenously injected with 100 µg DNP-BSA containing 0.5% Evans blue for 30 min. After 30 min, Evans blue was extracted, and the absorbance was measured at 630 nm. The data were expressed as the mean ± SD values of five independent experiments. *p < 0.05 and **p < 0.01.

Figure 8. HPLC chromatograms of HXZQ-OL (A) Contour plot (190–400 nm) (B) 276 nm. 5-HMF (1), liquiritin (2), narirutin (3), hesperidin (4), isoliquiritin (5), glycyrrhizin (6), honokiol (7) and magnolol (8) were identified. HPLC analysis was described in the materials and methods.