Kazak faecal microbiota transplantation induces short-chain fatty acids that promote glucagon-like peptide-1 secretion by regulating gut microbiota in db/db mice

Figures & data

Table 1. RT-qPCR primers for intestinal target bacteria.

Target bacteria	Target gene	Amplicon length (bp)	Primer sequences (5′-3′)	Tm (°C)
			(F, forward; R, reverse)
Clostridium (Da Silva et al. 2018)	16S rRNA	86	F: CATCCTGATGACGGTTTCTTAACC	58
			R: GTTGCGGGACTTAACCCA
Bacteroides (Jiang et al. 2014)	16S rRNA	202	F: CTGAACCAGCCAAGTAGCG	58
			R: CCGCAAACTTTCACAACTGACTTA
Sutterella (Williams et al. 2012)	16S rRNA	234	F: CGCGAAAAACCTTACCTAGCC	62
			R: GACGTGTGAGGCCCTAGCC
Bacteroides uniformis (Tong et al. 2011)	16S rRNA	112	F: TCTTCCGCATGGTAGAACTATTA	60
			R: ACCGTGTCTCAGTTCCAATGTG
Mucispirillum schaedleri	16S rRNA	178	F: CGAGCGTTGTTCGGAGTGACTG	65
			R: CCAGCCAGATTGCCGCCTTC
Faecalibacterium prausnitzii (Bartosch et al. 2004)	16S rRNA	177	F: GATGGCCTCGCGTCCGATTAG	60
			R: CCGAAGACCTTCTTCCTCC
Ruminococcus gnavus (Cao et al. 2016)	16S rRNA	103	F: GGACTGCATCGTCCAGAAAG	58
			R: AACGTCAGTCATCGTCCAGAAAG

Table 2. RT-qPCR primers for gene expression.

Primer name	Primer sequences (5′-3′)	Resource
	(F, forward; R, reverse)
GPR43	F: ATCCTCCTGCTTAATCTGACCC	NM_146187
	R: CGCACACGATCTTTGGTAGGT
GLP-1	F: CAAACCAAGATCACTGACAAGAAAT	Primer bank
	R: GGGTTACACAATGCTAGAGGGA
β-actin	F: CAACTTGATGTATGAAGGCTTTGGT	Primer bank
	R: ACTTTTATTGGTCTCAAGTCAGTGTACAG

Figure 1. The effects of faecal microbial transplantation from a Kazak individual with normal glucose tolerance on FBG (A) and PPG (B) levels in T2DM db/db mice. Data were analyzed using one-way ANOVA. ## p < 0.01 compared to db/m + PBS mice; *p < 0.05; **p < 0.01 compared to db/db + PBS mice.

Table 3. Effect of FMT-KNGT on blood glucose levels in mice ($\overline{x}$ ± s, mmol/L).

Blood glucose	Group	Time (Week)
		0w	6w	10w
FBG	db/m + PBS	5.04 ± 0.28	6.28 ± 0.37	6.48 ± 0.42
	db/db + PBS	16.81 ± 2.23##	20.66 ± 1.74##	24.19 ± 1.30##
	db/db + KNGT	16.78 ± 1.05	17.62 ± 0.87**	20.11 ± 1.59**
PPG	db/m + PBS	5.36 ± 0.23	6.72 ± 0.53	7.19 ± 0.40
	db/db + PBS	19.88 ± 1.04##	23.48 ± 1.77##	26.16 ± 1.58##
	db/db + KNGT	19.97 ± 0.65	20.38 ± 2.23**	20.49 ± 2.71*

Data were analyzed using one-way ANOVA. ##p < 0.01 compared to db/m + PBS mice; *p < 0.05; **p < 0.01 compared to db/db + PBS mice. 0w: n = 6; 6w: n = 6; 10w: n = 3.

Figure 2. The effects of faecal microbial transplantation from a Kazak individual with normal glucose tolerance on total cholesterol (TC) (A), triglycerides (TG) (B), LDL-C (C) and HDL-C (D) plasma levels in T2DM db/db mice. Data were analyzed using one-way ANOVA. ##p < 0.01 compared to db/m + PBS mice; *p < 0.05 and **p < 0.01 compared to db/db + PBS mice.

Table 4. Effect of FMT-KNGT on blood lipid levels in mice ($\overline{x}$ ± s, TC, TG: mmol/L; HDL-C, LDL-C: mg/dL).

Blood lipid	Group	Time (week)
		0w	6w	10w
TC	db/m + PBS	1.61 ± 0.27	1.89 ± 0.15	1.78 ± 0.16
	db/db + PBS	3.45 ± 0.61##	4.21 ± 0.38##	3.53 ± 0.16##
	db/db + KNGT	3.44 ± 0.43	3.15 ± 0.48**	3.16 ± 0.07*
TG	db/m + PBS	0.87 ± 0.13	0.88 ± 0.24	1.02 ± 0.02
	db/db + PBS	1.62 ± 0.24##	1.67 ± 0.09##	1.89 ± 0.07##
	db/db + KNGT	1.67 ± 0.16	1.40 ± 0.14**	1.29 ± 0.04**
LDL-C	db/m + PBS	3.11 ± 0.08	3.20 ± 0.05	3.08 ± 0.02
	db/db + PBS	4.43 ± 0.14##	4.21 ± 0.02##	4.34 ± 0.08##
	db/db + KNGT	4.27 ± 0.10	3.57 ± 0.08**	3.56 ± 0.07**
HDL-C	db/m + PBS	63.02 ± 2.28	70.30 ± 2.21	72.52 ± 1.37
	db/db + PBS	53.97 ± 2.18##	55.30 ± 0.89##	56.68 ± 0.69##
	db/db + KNGT	55.32 ± 1.99	58.28 ± 1.19*	59.24 ± 0.84*

Data were analyzed using one-way ANOVA. ##p < 0.01 compared to db/m + PBS mice; *p < 0.05; **p < 0.01 compared to db/db + PBS mice. 0w: n = 6; 6w: n = 6; 10w: n = 3.

Figure 3. Relative abundance of gut microbiota species at the genus (A) level in faecal samples from the KNGT donor. Relative abundance differences of species at the genus (B) and species (C) levels from each mouse group after FMT-KNGT. Data are presented as percentages. Data were analyzed using the Kruskal–Wallis test. For B and C, mouse faeces were tested at week 6. ‘Others’ refer to bacteria not indicated in the figure.

Table 5. The relative abundance of bacteria in faecal samples from the KNGT donor at the genus level (%).

Bacteria	Relative abundance
Bacteroides	1.53
Blautia	0.19
Butyricimonas	0.28
Clostridium	0.13
Collinsella	0.01
Coprococcus	0.64
Dialister	3.77
Dorea	0.11
Enterobacter	0.11
Escherichia	1.39
Eubacterium	0.05
Faecalibacterium	1.44
Gemmiger	0.41
Oscillospira	1.63
Parabacteroides	0.33
Prevotella	78.04
Roseburia	0.61
Ruminococcus	3.81
Sutterella	0.67
Trabulsiella	0.05
Unclassified	3.78
Others	1.04

Table 6. The relative abundance of the dominant bacteria in faecal samples from mice at the genus level (%, n = 6).

Bacteria	db/m + PBS		db/db + PBS		db/db + KNGT
	Mean	SD	Mean	SD	Mean	SD
Bacteroides	2.32	2.2	4.16	2.00	4.14	2.32
Butyricicoccus	0.26	0.08	0.45	0.19	0.27	0.3
Clostridium	0.25	0.28	0.10	0.14	0.12	0.14
Coprococcus	2.10	2.65	0.45	0.36	0.73	0.67
Dorea	0.46	0.97	0.14	0.1	0.42	0.71
Escherichia	0.03	0.02	6.45	9.68	1.85	0.48
Mucispirillum	0.02	0.03	0.83	0.89	0.16	0.25
Odoribacter	0.21	0.25	1.66	2.3	1.00	0.96
Sutterella	3.78	1.39	0.17	0.18	0.18	0.1
Unclassified	66.13		61.73		66.97
Others	24.45		23.85		24.14

Results were obtained using the Kruskal–Wallis test. Mouse faeces were tested at week 6. ‘Others’ refer to bacteria not indicated in the table.

Table 7. The relative abundance of the dominant bacteria in faecal samples from mice at the species level (%, n = 6).

Bacteria	db/m + PBS		db/db + PBS		db/db + KNGT
	Mean	SD	Mean	SD	Mean	SD
Bacteroides uniformis	0.007	0.004	0.001#	0.001	0.038*	0.04
Bacteroides acidifaciens	0.265	0.32	0.885	0.80	0.660	0.43
Bacteroides caccae	0.153	0.11	1.591	1.24	2.067	1.91
Butyricicoccus pullicaecorum	0.256	0.08	0.453	0.19	0.269	0.3
Helicobacter hepaticus	0.017	0.01	0.391	0.29	0.298	0.27
Mucispirillum schaedleri	0.021	0.03	0.830	1.89	0.161	0.25
Ruminococcus flavefaciens	0.306	0.32	0.000	0.00	0.000	0
Ruminococcus gnavus	2.435	3.71	1.044	0.38	1.151	1.27
Unclassified	93.939		87.695		93.064
Others	2.602		7.110		2.293

Results were obtained using the Kruskal–Wallis test. Mouse faeces were tested at week 6. ‘Others’ refer to bacteria not indicated in the table. #p < 0.05 compared to db/m + PBS mice. *p < 0.05 compared to db/db + PBS mice.

Figure 4. Quantification of gut bacteria in each group over time. SQ represents the starting template quantity of Mucispirillum schaedleri (A), Clostridium (B), Sutterella (C), Bacteroides uniformis (D), Ruminococcus gnavus (E), Bacteroides (F) and Faecalibacterium prausnitzii (G). On the horizontal axis, 0w, 6w, and 10w represent 0, 6 and 10 weeks after FMT-KNGT intervention. Data were analyzed using one-way ANOVA. #p < 0.05 and ##p < 0.01 compared to db/m + PBS mice. **p < 0.01 compared to db/db + PBS mice.

Table 8. Effect of FMT- KNGT on the levels of target bacteria in the faeces of mice by RT-qPCR ($\overline{x}$ ± s, LogSQ).

Bacteria	Group	Time (Week)
		0w	6w	10w
Mucispirillum schaedleri	db/m + PBS	2.28 ± 0.20	2.59 ± 0.22	3.01 ± 0.10
	db/db + PBS	3.17 ± 0.48#	3.60 ± 0.54##	4.11 ± 0.43##
	db/db + KNGT	2.98 ± 0.33#	2.88 ± 0.39**	3.12 ± 0.30**
Clostridium	db/m + PBS	1.34 ± 0.12	1.22 ± 0.11	1.16 ± 0.07
	db/db + PBS	1.12 ± 0.08#	1.02 ± 0.07#	0.92 ± 0.07#
	db/db + KNGT	1.19 ± 0.14#	1.43 ± 0.17**	1.21 ± 0.05**
Sutterella	db/m + PBS	2.54 ± 0.30	2.24 ± 0.22	2.02 ± 0.05
	db/db + PBS	2.00 ± 0.25#	1.64 ± 0.15#	1.66 ± 0.22#
	db/db + KNGT	2.15 ± 0.31#	2.05 ± 0.59	1.82 ± 0.15
Bacteroides uniformis	db/m + PBS	2.27 ± 0.34	2.31 ± 0.22	1.84 ± 0.09
	db/db + PBS	2.07 ± 0.18	2.16 ± 0.14	1.65 ± 0.23
	db/db + KNGT	2.07 ± 0.17	2.29 ± 0.17	1.79 ± 0.09
Ruminococcus gnavus	db/m + PBS	2.83 ± 0.63	2.57 ± 0.75	2.20 ± 0.61
	db/db + PBS	2.12 ± 0.46#	1.62 ± 0.28#	1.23 ± 0.20
	db/db + KNGT	2.25 ± 0.60	2.20 ± 0.61	1.72 ± 0.43
Bacteroides	db/m + PBS	5.54 ± 0.86	5.02 ± 0.23	4.47 ± 0.23
	db/db + PBS	4.23 ± 0.31#	4.68 ± 0.10#	3.86 ± 0.25
	db/db + KNGT	4.37 ± 0.36#	4.78 ± 0.29	4.34 ± 0.51
Faecalibacterium prausnitzii	db/m + PBS	2.80 ± 0.38	2.94 ± 0.36	2.91 ± 0.04
	db/db + PBS	2.39 ± 0.51	2.19 ± 0.53#	2.08 ± 0.23#
	db/db + KNGT	2.37 ± 0.43	2.50 ± 0.44	2.62 ± 0.43

SQ represents the starting template quantity. Data were analyzed using one-way ANOVA. #p < 0.05; ##p < 0.01 compared to db/m + PBS mice; **p < 0.01 compared to db/db + PBS mice. 0w: n = 6, 6w: n = 6, 10w: n = 3.

Figure 5. Gas chromatography comparisons between SCFA standards (A) and faecal samples (B) a = acetic acid, b = propionic acid, c = butyric acid, d = 2-ethyl butyric acid. SCFA data at 0, 6 and 10 weeks for faecal samples from mice after FMT-KNGT treatment (C). Data were analyzed using one-way ANOVA. *p < 0.05, **p < 0.01 compared to db/db + PBS mice.

Table 9. Concentrations of acetic acid, propionic acid and butyrate acid in faecal samples of mice ($\overline{x}$  ± s, mmol/L).

SCFAs	Group	Time (Week)
		0w	6w	10w
Acetic acid	db/m + PBS	5.39 ± 0.98	6.05 ± 1.03	12.32 ± 2.60
	db/db + PBS	6.86 ± 1.77	4.52 ± 0.59	11.97 ± 3.06
	db/db + KNGT	6.60 ± 1.98	6.60 ± 1.32*	22.68 ± 1.82**
Propionic acid	db/m + PBS	0.85 ± 0.22	0.87 ± 0.19	2.09 ± 0.47
	db/db + PBS	0.67 ± 0.15	0.75 ± 0.18	1.87 ± 0.47
	db/db + KNGT	0.64 ± 0.21	0.66 ± 0.07	1.93 ± 0.60
Butyric acid	db/m + PBS	0.95 ± 0.25	0.97 ± 0.27	2.13 ± 0.27
	db/db + PBS	1.07 ± 0.48	1.17 ± 0.41	1.87 ± 0.15
	db/db + KNGT	1.09 ± 0.20	1.17 ± 0.30	4.13 ± 1.09*

Data were analyzed using one-way ANOVA. *p < 0.05; **p < 0.01 compared to db/db + PBS mice. 0w: n = 6, 6w: n = 6, 10w: n = 3.

Figure 6. GPR43 mRNA (A) and GLP-1 (B) levels in colon tissues from each mouse group after FMT-KNGT at 0, 6 and 10 weeks. Data were analyzed using one-way ANOVA. #p < 0.05 compared to db/m + PBS mice. *p < 0.05 compared to db/db + PBS mice.

Table 10. GPR43 and GLP-1 mRNA expression in colonic tissue of mice ($\overline{x}$ ± s, n = 3).

mRNA	Group	Time (week)
		0w	6w	10w
GPR43	db/m + PBS	1.08 ± 0.23	1.05 ± 0.07	1.37 ± 0.23
	db/db + PBS	0.50 ± 0.15#	0.44 ± 0.17#	1.07 ± 0.70
	db/db + KNGT	0.60 ± 0.10#	0.82 ± 0.16*	1.16 ± 0.21
GLP-1	db/m + PBS	1.04 ± 0.30	1.00 ± 0.37	1.19 ± 0.58
	db/db + PBS	0.87 ± 0.25	0.80 ± 0.47	0.75 ± 0.24
	db/db + KNGT	0.83 ± 0.43	0.92 ± 0.44	1.01 ± 0.63

Data were analyzed using one-way ANOVA. #p < 0.05 compared to db/m + PBS mice; *p < 0.05 compared to db/db + PBS mice.

Figure 7. GLP-1 protein expression in the colon tissue of each mouse group after FMT-KNGT at 0, 6 and 10 weeks. The grey values were analyzed by ImageJ. Data are presented as the mean ± SD values. *p < 0.05 compared to db/m + PBS mice. #p < 0.05 compared to db/db + PBS mice.

Table 11. Protein expression of GLP-1 in colonic tissue of mice ($\overline{x}$ ± s, n = 3).

Protein expression	Group	Time (Week)
		0w	6w	10w
GLP-1	db/m + PBS	1.08 ± 0.08	1.03 ± 0.07	0.82 ± 0.14
	db/db + PBS	0.89 ± 0.40	0.59 ± 0.27#	0.40 ± 0.09#
	db/db + KNGT	0.96 ± 0.22	0.73 ± 0.22	0.62 ± 0.20*

Data were analyzed using one-way ANOVA. *p < 0.05 compared to db/m + PBS mice; #p < 0.05 compared to db/db + PBS mice.

Figure 8. Correlations between faecal target bacteria and plasma glycolipid levels in three groups mice treated with FMT-KNGT for 6 weeks (A) and 10 weeks (B). R value is between 0.6∼-0.6; *p < 0.05, **p < 0.01.

Da Silva H, Teterina A, Comelli E, Taibi A, Arendt B, Fischer S, Lou W, Allard J. 2018. Nonalcoholic fatty liver disease is associated with dysbiosis independent of body mass index and insulin resistance. Sci Rep. 8(1):1466.

 PubMedGoogle Scholar

Jiang M, Gao H, Yao P. 2014. Quantification of intestinal microflora in ulcerative colitis patients using real time PCR. WCJD. 22(4):596–600 (Chinese).

 Google Scholar

Williams B, Hornig M, Parekh T, Lipkin W. 2012. Application of novel PCR-based methods for detection, quantitation, and phylogenetic characterization of Sutterella species in intestinal biopsy samples from children with autism and gastrointestinal disturbances. mBio. 3(1):e00261-11.

 PubMed Web of Science ®Google Scholar

Tong J, Liu C, Summanen P, Xu H, Finegold S. 2011. Application of quantitative real-time PCR for rapid identification of Bacteroides fragilis group and related organisms in human wound samples. Anaerobe. 17(2):64–68.

 PubMed Web of Science ®Google Scholar

Bartosch S, Fite A, Macfarlane G, McMurdo M. 2004. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 70(6):3575–3581.

 PubMed Web of Science ®Google Scholar

Cao H, Wang W, Lu R, Xu X, Chen L. 2016. Quantitative research of the main mucosa-associated microbiota in patients with active and remissional ulceraive colitis. Chin J Exp Surg. 33:1109–1112.

 Google Scholar