QiShenYiQi pills, a Chinese patent medicine, increase bioavailability of atorvastatin by inhibiting Mrp2 expression in rats

Figures & data

Figure 1. The product ion mass spectra of ATV, o-ATV, p-ATV and SVA. (A) ATV; (B) o-ATV; (C) p-ATV; (D) SVA.

Table 1. Experimental setting of the tandem mass spectrometry for ATV, o-ATV, p-ATV and SVA.

Experimental setting	ATV	o-ATV	p-ATV	SVA
Ion pairs	557.2→278.1	573.3→278.1	573.3→278.1	435.3→319.3
Ion source temperature (°C)	450	450	450	450
Ion spray voltage (V)	−4500	−4500	−4500	−4500
Declustering Potential (V)	−100	−75	−85	−80
Collision Energy (eV)	−60	−56	−58	−22

ATV: atorvastatin; o-ATV: ortho-hydroxy atorvastatin; p-ATV: para-hydroxy atorvastatin; SVA: simvastatin acid.

Table 2. The mRNA primer sequences.

Genes	Forward	Reverse
Cyp3A1	TGCATTGGCATGAGGTTTGC	TTCAGCAGAACTCCTTGAGGG
Cyp3A2	TTCTAAAGGTTCTGCCACGGG	CCATCACAGACCTTGCCAACT
Slco1b2	GCTGATTGGAATTGGCTGCTT	GGTGAAGGTCCAGTGGGTGA
Abcb1a	TCTGGTATGGGACTTCCTTGGT	TCCTTGTATGTTGTCGGGTTTG
Slco2b1	TGCGAGTGTTGGCCTGGAT	TCATGGTCATAGTAGCGGCAGA
Abcg2	TGAAGAGTGGCTTTCTAGTCCG	TTGAAATTGGCAGGTTGAGGTG
Abcc2	ATGCGGCGTATTCCAGTTTC	TTGCTGGTGACTGACCTTGTTT
β-actin	TGCTATGTTGCCCTAGACTTCG	GTTGGCATAGAGGTCTTTACGG

Figure 2. The pharmacokinetic profiles of ATV, o-ATV and p-ATV after oral administration of ATV without or with QSYQ in rats. (A) ATV; (B) o-ATV; (C) p-ATV. Data are shown as mean ± SD (n = 5). *p < 0.05, **p < 0.01 compared to without QSYQ.

Figure 3. The pharmacokinetic profiles of ATV and o-ATV after intravenous administration of ATV without or with QSYQ in rats. (A) ATV; (B) o-ATV. Data are shown as mean ± SD (n = 5).

Table 3. The pharmacokinetic parameters of ATV, o-ATV and p-ATV in rat plasma after oral administration of ATV with or without QSYQ.

Oral administration PK parameters	ATV		o-ATV		p-ATV
	Without QSYQ	With QSYQ	Without QSYQ	With QSYQ	Without QSYQ	With QSYQ
AUC0–12 h (ng/mL/h)	226.67 ± 42.11	408.70 ± 161.75*	729.47 ± 150.54	906.14 ± 145.34	34.91 ± 18.77	59.24 ± 25.12
AUC0–∞ (ng/mL/h)	273.36 ± 93.26	410.97 ± 164.13	865.33 ± 229.23	949.09 ± 133.93	56.26 ± 32.69	60.91 ± 25.78
t1/2 (h)	5.47 ± 3.46	1.40 ± 0.41*	4.15 ± 1.99	2.56 ± 0.98	9.05 ± 3.31	2.17 ± 0.74**
Tmax (h)	0.43 ± 0.33	0.95 ± 0.11	1.05 ± 0.27	1	1.25 ± 0.35	1
Vz (L/kg)	270.51 ± 119.65	54.71 ± 26.62*	68.79 ± 23.90	40.25 ± 18.91	2814.17 ± 1409.11	601.61 ± 378.37*
CLz (L/h/kg)	39.64 ± 11.63	27.02 ± 8.72	12.22 ± 3.21	10.69 ± 1.41	235.70 ± 142.44	187.55 ± 69.46
Cmax (ng/mL)	101.46 ± 26.18	198.00 ± 51.69**	203.06 ± 84.97	299.60 ± 46.70	9.07 ± 6.20	23.10 ± 8.70*

Data are shown as mean ± SD (n = 5).

ATV: atorvastatin; o-ATV: ortho-hydroxy atorvastatin; p-ATV: para-hydroxy atorvastatin; QSYQ: QiShenYiQi pills.

*p < 0.05, **p < 0.01 compared to without QSYQ.

Table 4. The pharmacokinetic parameters of ATV and o-ATV in rat plasma after intravenous administration of ATV with or without QSYQ.

Intravenous administration PK parameter	ATV		o-ATV
	Without QSYQ	With QSYQ	Without QSYQ	With QSYQ
AUC0–6 h (ng/mL/h)	549.50 ± 99.25	548.92 ± 90.01	42.66 ± 19.65	55.21 ± 28.56
AUC0–∞ (ng/mL/h)	550.62 ± 99.57	549.99 ± 90.71	50.01 ± 20.42	85.52 ± 75.55
t1/2 (h)	0.71 ± 0.90	0.74 ± 0.12	2.09 ± 0.88	3.04 ± 1.79
Vz (L/kg)	3.83 ± 1.12	3.90 ± 0.34	138.97 ± 67.25	118.41 ± 45.57
CLz (L/h/kg)	3.73 ± 0.70	3.73 ± 0.73	47.06 ± 22.27	32.97 ± 13.85

ATV: atorvastatin; o-ATV: ortho-hydroxy atorvastatin; QSYQ: QiShenYiQi pills.

Data are shown as mean ± SD (n = 5).

Figure 4. Relative mRNA expression of Cyp3A1, Cyp3A2, Slco1b2 in liver and Abcb1a, Slco2b1, Abcg2, Abcc2 in jejunum and ileum after oral administration of ATV without or with QSYQ. (A) Relative mRNA expression of Cyp3A1, Cyp3A2, Slco1b2 in liver; (B) Relative mRNA expression of Abcb1a, Slco2b1, Abcg2, Abcc2 in jejunum; (C) Relative mRNA expression of Abcb1a, Slco2b1, Abcg2, Abcc2 in ileum. Data are shown as mean ± SD (n = 3). *p < 0.05, **p < 0.01 compared to without QSYQ.

Figure 5. Relative mRNA expression of Cyp3A1, Cyp3A2, Slco1b2 in liver and Abcb1a, Slco2b1, Abcg2, Abcc2 in jejunum and ileum after intravenous administration of ATV without or with QSYQ. (A) Relative mRNA expression of Cyp3A1, Cyp3A2, Slco1b2 in liver; (B) Relative mRNA expression of Abcb1a, Slco2b1, Abcg2, Abcc2 in jejunum; (C) Relative mRNA expression of Abcb1a, Slco2b1, Abcg2, Abcc2 in ileum. Data are shown as mean ± SD (n = 3). *p < 0.05 compared to without QSYQ.

Figure 6. Protein expression of P-glycoprotein in jejunum and Mrp2 in ileum after oral or intravenous administration of ATV without or with QSYQ. (A) and (B) Protein expression of P-glycoprotein in jejunum; (C) and (D) Protein expression of Mrp2 in ileum. Data are shown as mean ± SD (n = 3). *p < 0.05 compared to without QSYQ.