Novel Method for the Synthesis of 2′ -Phosphorylated Oligonucleotides

Abstract

We have developed a new method for the preparation of oligodeoxyribonucleotides and oligo(2′-O-methylribonucleotides) that contain a 2′-phosphorylated ribonucleoside residue, and optimized it to avoid 2′ -3′ -isomerization and chain cleavage. Structures of the 2′ -phosphorylated oligonucleotides were confirmed by MALDI-TOF MS and enzymatic digestion, and the stability of their duplexes with DNA and RNA was investigated. 2′-Phosphorylated oligonucleotides may be useful intermediates for the introduction of various chemical groups for a wide range of applications.

Keywords:

• 2′-Modification
• oligodeoxyribonucleotides
• oligo(2′-O-methylribonucleotides)
• 2′-phosphate
• solid-phase synthesis

Acknowledgments

The authors are grateful to Dr. Vladimir V. Koval and Yulia V. Gerassimova for the MALDI-TOF analyses, Alexander A. Lomzov for his help with the UV melting studies, and Dr. Marina N. Repkova for some oligonucleotide syntheses. The work was supported by Russian Foundation for Basic Research grant 05-04-48341, INTAS (project 03-51-5281), and the 2005 Lavrentiev Competition of Young Scientists Projects SB RAS.

Notes

^{a a} U ^p or A ^p – 2′ -phosphorylated ribonucleotide, N^m – 2′ −O-methylribonucleotide;

^b Isolated yield after purification as quantified by A₂₆₀;

^c Ion-exchange HPLC, 4.6 × 250 mm Polysil SA column (“Teor. Praktika”, Russia), 0–0.4M KH₂PO₄, 20% MeCN, 50 min;

^d AP – alkaline phosphatase.

^e Conditions: 0.1M NaCl, 10 mM Na-cacodylate, pH 7.4, 1 mM Na₂EDTA; [oligonucleotide] = [target] = 1.3 · 10⁻⁵ M, target: r(GCCUGGAGCUUGAUGC) or d(GCCTGGAGCTTGATGC) or d(TGCCTGGAGCTGCTTGATGC); Δ T_m is the difference between the T_m for the duplexes of the unmodified and the 2′ -phosphorylated oligonucleotide.