Effects of ultra-weak fractal electromagnetic signals on the aqueous phase in living systems: a test-case analysis of molecular rejuvenation markers in fibroblasts

Figures & data

Figure 1. Flow chart. Simplified sketch of the performed protocol. HDF-cells are cultivated in 25 cm² flask; upon confluence transfer into six 6-multiwell plates (working volume: 1.90–2.90 mL, surface/well: 9.6 cm²); exposure of three plates to the uwf-EM signal (for 10 min, distance: approx. 5 mm from the log-antenna); incubation of all six plates in different compartments of the incubator for up to 96 hours; execution of PCR (determination of HDF-viability and genetic expression of IL-6, TNFa, MMP-1, collagen and elastin) followed by a repetition of the 10 min uwf-EM treatment cycle on exposed cells every 24 hours. Note: the HDF-well in this plate was used as for monitoring purposes only. The HDF-well in this plate was used as for monitoring purposes only.

Table 1. Sense and antisense primers as obtained by real-time PCR.

Gene	Primers sequence	Conditions	Product size (bp)
MMP-1	5′-CTC CAG CAT CCG ACA AGA AGC-3′ 5′-GAG GTC GTA GGC TGT TCT TCG-3′	1ʹ at 94°C,1ʹ at 63°C, 1ʹ at 72°C for 33 cycles	234
IL-6	5ʹ-ATGACTTCCAAGCTGGCCGTG-3ʹ 5ʹ-TGAATTCTCAGCCCTCTTCAAAAACTTCTC-3’	1ʹat 94°C, 1ʹ at 56°C, 1”’at 72°C for 33 cycles	297
Collagen I	5′-CCA GCC ATC AGC CAT GAG GGT-3′ 5′-AAC CGG TAG TCG GTA CTC CCA-3′	1ʹ at 94°C,1ʹ at 63°C, 1ʹ at 72°C for 33 cycles	254
Elastin	5ʹ-CCGACTACTACGCCAAGGAGGTCAC-3ʹ 5ʹ-AGGCCGGTTCATGCCATGAATGGTG-3’	1ʹat 94°C, 1ʹ at 60°C, 2ʹat 72°C for 32 cycles	439
β-actin	5ʹ-TGACGGGGTCACCCACACTGTGCCCATCTA-3ʹ 5ʹ-CTAGAAGCATTGCGGTGGACGATGGAGGG-3’	30”at 95°C, 1” at 56°C, 30”at 72°C for 35 cycles	661
TNF-α	5ʹ- CAGAGGGAAGAGTTCCCCAG −3ʹ 5ʹ- CCTTGGTCTGGTAGGAGACG −3’	30”at 95°C, 45” at 57°C, 30”at 72°C for 35 cycles	324

Table 2. Two sided t- and p-values of t-test statistics. In accordance with the figures below, the diverging trends of controls and uwf-EMF-exposed cultures with a significance level of p < α (0.05) yields a non-significant difference in HDF data. However, H₀ is rejected in the cases of IL-6, TNF-α and MM-1 (shaded areas); this is in line with t_crit being ≥2.777 among all data sets; this is further supported by t_stat > t_crit leading also to the rejection of H_0.

		Time [h]
		0	24	48	72	96
HDF	tstat	−1.2247	−2.1381	−1.2247	−0.9733	−1.1767
	p2-sided	2.1318	0.0993	0.2879	0.3855	0.3046
IL-6	tstat	1.0000	0.0000	0.1796	5.4222	4.2603
	p2-sided	0.3910	1.0000	0.8662	0.0123	0.0237
TNF-a	tstat	−3.0619	0.0554	0.4899	0.5406	3.6878
	p2-sided	0.0376	0.9593	0.6499	0.6264	0.0211
MMP-1	tstat	−0.4000	−0.5917	5.1257	7.0218	12.2474
	p2-sided	0.7096	0.6140	0.0069	0.0022	0.0003
Collagen	tstat	0.4472	−0.1539	−1.1097	−0.8620	−1.5308
	p2-sided	0.6779	0.8851	0.3481	0.4796	0.2655
Elastin	tstat	1.2247	1.6923	−0.6682	0.8771	−0.8859
	p2-sided	0.2879	0.2327	0.5728	0.4730	0.4409

Figure 2. Cell viability measurement. HDF viability after treatment with and without uwf-EM exposure.

Figure 3. Real-time PCR analysis using specific primers for cytokines. Relative IL-6 gene expression from HDF (left) as well as TNF-α gene expression from HDF (right), treated with and without uwf-EM signals.

Figure 4. Real-time PCR analysis using specific primers for MMP-1, collagen type-I and elastin. Relative MMP-1 expression from HDF (top left), relative collagen type-1 gene expression from HDF (top right) and relative elastin gene expression from HDF (bottom), treated with and without uwf-EM signals.

Figure 5. Generic setup of the FRACTOS device with cell culture.

Table 3. Magnetic flux densities of background and FRACTOS logarithmic antenna in three repeats. Background values denote signal strength with full set-up yet at min. signal intensity, whereas 100% measurements denote maximum intensity of the emitted signal originating from the log-antenna.

	min	max	avg	stdev	95^th%ile	unit
backgnd-1	0.30	3.60	1.10	0.38	1.95	[nT]
backgnd-2	0.30	3.90	1.18	0.38	1.74	[nT]
backgnd-3	0.40	3.90	1.20	0.38	1.80	[nT]
Vol@100%-1	0.60	12.90	2.73	1.41	5.72	[nT]
Vol@100%-2	0.70	12.90	2.78	1.38	5.78	[nT]
Vol@100%-3	0.60	12.90	2.77	1.38	5.72	[nT]

Figure 6. Linear regime (red segment of fitting) between power logarithm and frequency logarithm in the frequency window of 0.5 - 20 kHz of the used audio signal (whiteHBfractal.wav). The polynomial fit includes also the sub-500 Hz regime down to 20 Hz (see text for details).