HIV-1 Tat increases BAG3 via NF-κB signaling to induce autophagy during HIV-associated neurocognitive disorder

Figures & data

Table 1. The information of the macaques in this study

Animal No.	Sex	Age at virus inoculation (weeks)	Age at Death (weeks)	Duration of infection (weeks)	Viral inoculums	Viral RNA load in plasma at autopsy (copies/ml)	Information	Increase of BAG3*
1	F	40	68	28	SHIV-162P4	7,930,000	Body weight loss and morbid	3
2	M	40	68	28	SHIV-162P4	1,000,000	Body weight loss and morbid	2
3	F	40	68	28	SHIV-162P4	1,660,000	Body weight loss and morbid	3
4	M	40	68	28	SHIV-162P4	2,290,000	Body weight loss and morbid	3
5	F	40	68	28	SHIV-162P4	1,340,000	Body weight loss and morbid	2
6	M	40	68	28	SHIV-162P4	2,050,000	Body weight loss and morbid	2
7	F	40	68	28	SHIV-162P4	4,970,000	Body weight loss and morbid	2
8	M	40	68	28	SHIV-162P4	9,650,000	Body weight loss and morbid	2
10	F		156	None	Control	0		0
11	M		210	None	Control	0		0
12	M		209	None	Control	0		0
13	M		253	None	Control	0		0

*, Immunohistochemical staining for each antigen was assessed semiquantitatively by scoring from 0 to 3 in each animal.

F, female; M, male; SHIV-162.P4, simian immunodeficiency virus-human immunodeficiency virus chimeric virus, BAG3, Bcl-2-associated athanogene 3

Table 2. Primers for the qRT-PCR Assay

Name	Forward primer (5ʹ-3ʹ)	Reverse primer (5ʹ-3ʹ)
BAG3-human	AGCTCCGACCAGGCTACATT	GGATAGACATGGAAAGGGTGC
BAG3-macaques	CGCAAAGAGGCGGATTCTAAAC	CTGGGAGAAGGACAAGGAACTGAA
β-actin-human	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT
β-actin-macaques	ATCGTGCGTGACATTAAGGAGAAGC	ATGCCCAGGAAGGAAGGTTGGA

Figure 1. BAG3 is increased in astrocytes in the frontal cortex of SHIV-infected macaques

(A-B) Increased BAG3 (brown) in the frontal cortex of SHIV-infected group (#5) (right) compared with control group (#11) (left) was analyzed by IHC. C. Statistical analysis of SHIV-infected group (#1-#8) and control group (#10–13) (***P < 0.001). (D–E) Increased BAG3 in astrocytes of SHIV-infected group (#5) (right) compared with control group (#11) (left) was shown by BAG3 (red) and GFAP (blue) double-labeled IHC. (F) Statistical analysis of SHIV-infected group (#1-#8) and control group (#10–13) (***P < 0.001). (G–H) Western blotting analysis of BAG3 expression in the frontal cortex of SHIV-infected group (#1-#4) compared with control group (#10-#11) and statistical analysis (*P < 0.05). (I) The qRT-PCR analysis of BAG3 mRNA levels in SHIV-infected group (#1-#4) and control group (#10-#11). Statistical analysis of all Western blotting from at least three independent experiments. Ctr: control group; SHIV: SHIV-infected group.

Figure 2. HIV-1 Tat upregulates BAG3 in U87 cells

(A) U87 cells were transfected with pcDNA3.1-Tat-HA (4µg) or pcDNA3.1-HA (4µg) for 48 hours and the expression of HIV-1 Tat was measured by western blotting. (B) U87 cells were transfected with pcDNA3.1-Tat-HA or pcDNA3.1-HA at different time points and the expression of BAG3 was measured by western blotting. (C) Statistical analysis of C (*P < 0.05; **P < 0.01). (D) U87 cells were transfected with pcDNA3.1-Tat-HA or pcDNA3.1-HA at different time points and the mRNA level of BAG3 was measured by qRT-PCR. Statistical analysis of all Western blotting from at least three independent experiments. Tat: pcDNA3.1-Tat-HA; Vehicle: pcDNA3.1-HA.

Figure 3. HIV-1 Tat activates the NF-κB signaling

U87 cells were transfected with pcDNA3.1-Tat-HA only or pcDNA3.1-HA only for 48 hours, or were treated with the NF-κB signaling inhibitor CAPE (30 µg/ml) for 24 hours following transfection with pcDNA3.1-Tat-HA for 24 hours. (A) Expression and nuclear translocation of p65 were observed by confocal microscopy. Red represented expression and distribution of p65, green represented expression of HIV-1 Tat and blue represented nuclear staining by DAPI. All pictures were magnified 600 × . (B) The expression of IκBα, phosphorylated IκBα, phosphorylated p65 and BAG3 were analyzed by western blotting. (C–F) Statistical analysis of B (*P < 0.05; **P < 0.01; ***P < 0.001). Statistical analysis of all Western blotting from at least three independent experiments. Tat: pcDNA3.1-Tat-HA; Vehicle: pcDNA3.1-HA; CAPE: an NF-κB pathway inhibitor.

Figure 4. HIV-1 Tat induces autophagy by BAG3-dependent manner

(A) U87 cells were transfected with pEGFP-C3-BAG3-GFP or pEGFP-C3-GFP only for 48 hours, or were treated with the autophagy inhibitor Bafilomycin A1 (Baf-A1) (100 nM) for 24 hours following transfection with pEGFP-C3-BAG3-GFP for 24 hours. The expression of LC3B was analyzed by western blotting. (B) statistical analysis of A (**P < 0.01). (C) U87 cells were transfected with pcDNA3.1-HA or pcDNA3.1-Tat-HA only for 48 hours, or were treated with pcDNA3.1-Tat-HA for 48 hours following transfection with GV112-BAG3-shRNA or GV112-Scramble-shRNA for 24 hours. The expression of BAG3, LC3B and p62 were analyzed by western blotting. (D–F) Statistical analysis of C (**P < 0.01; ***P < 0.001). G. U87 cells were transfected with pcDNA3.1-Tat-HA only or pcDNA3.1-HA only for 48 hours, or were treated with the NF-κB signaling inhibitor CAPE (30 µg/ml) for 24 hours following transfection with pcDNA3.1-Tat-HA for 24 hours. The expression of BAG3, LC3B and p62 were analyzed by western blotting. (H–J) statistical analysis of G (*P < 0.05; **P < 0.01; ***P < 0.001). Statistical analysis of all Western blotting from at least three independent experiments. BAG3: pEGFP-C3-BAG3-GFP; Tat: pcDNA3.1-Tat-HA; Vehicle: pEGFP-C3-GFP or pcDNA3.1-HA; BAG3-shRNA: GV112-BAG3-shRNA; Scramble-shRNA: GV112-Scramble-shRNA; CAPE: an NF-κB signaling inhibitor.