Inhibition of microRNA-300 inhibits cell adhesion, migration, and invasion of prostate cancer cells by promoting the expression of DAB1

Figures & data

Table 1. Primer sequences for RT-qPCR

Gene	Primer sequence (5′-3′)
miR-300	F: CGCTATACAAGGGCAGACT
	R: CAGTGCGTGTCGTGGAGT
miR-381-3p	F: TAATCTGACTATACAAGGGCAAGCT
	R: TATGGTTGTTCTGCTCTCTGTCTC
miR-186-5p	F: TCAAAGAATTCTCCTTTTGGGCT
	R: CGCTTCACGAATTTGCGTGTCAT
miR-29a-3p	F: CGTAGCACCATCTGAAATCG
	R: GTGCAGGGTCCGAGGT
miR-149-5p	F: CAGGAGTTGTAAATCCGAGCCG
	R: TTCATAGGTCAGAGCCCTGTGCA
U6	F: GTGCTCGCTTCGGCAGCACATATAC
	R: AAAAATATGGAACGCTTCACGAATTTG
DAB1	F: ATCGCAGTGAAGCCACTTTGATA
	R: AGCTGCGGAAACTTCATCAATC
Rap1	F: GCCACCCGGGAGTTTGA
	R: GGGTGGATCATCATCACACATAGT
RAC1	F: AAGGAGATTGGTGCTGTAAAA
	R: AACCTTTGTACGCTTTGCTCA
MMP2	F: ACCTGGATGC-CGTCGTGGAC
	R: GTGGCAGCACCAGGGCAGC
MMP9	F: TTGACAGCGACAAGAAGTGG
	R: GCCATTCACGTCGTCCTTAT
CyclinD1	F: CCTGTCCTACTACCGAATCA
	R: TCCTCCTCTTCCTCCTCCTC
CyclinE	F: GCTTATTGGGATTTCATCTTTA
	R: TCTGTGGGTCTGTATGTTGTGT
GAPDH	F: TGATGACATCAAGAAGGTGGTGAAG
	R: TCCTTGGAGGCCATGTGGGCCAT

RT-qPCR, reverse transcription quantitative polymerase chain reaction; F, forward; R, reverse; miR-300, microRNA-300; DAB1, disabled-1; Rap1, rhoptry-associated protein 1; RAC1, Rac family small GTPase 1; MMP, matrix metallopeptidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Table 2. The PC-related biological processes

Name	GO ID	Score
negative regulation of axonogenesis	GO: 0050771	9.40
dendritic spine morphogenesis	GO: 0060997	9.37
response to organic substance	GO: 0010033	9.33
DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator	GO: 0006978	9.26
positive regulation of transcription, DNA-templated	GO: 0045893	9.10
Prostate gland development	GO: 0030850	9.02
Prostate gland growth	GO: 0060736	8.96

Name referred to the detailed names of the items of this biological process, the GO ID referred to the number of this item in GO, and the Score referred to the score on the relationship between the item and PC. PC, prostatic cancer.

Table 3. Binding of miRs and DAB1

ID	mirSVR score	PhastCons score
hsa-miR-381-3p	−0.7682	0.6168
hsa-miR-300	−0.7645	0.6168
hsa-miR-186-5p	−0.7627	0.6168
hsa-miR-29a-3p	−0.6916	0.7224
hsa-miR-149-5p	−0.3786	0.6630

Gens referred to the name of this gene; miRNA referred to the predicted miRNAs; mirSVR score referred to the score of thermodynamic stability (< −0.1), and the lower the score, the stronger the binding stability of miRNA-mRNA and the greater the possibility of corresponding down-regulated miRNA; PhastCons score referred to the degree of evolutionary conservative character of untranslated regions of genes in species, the bigger the conservative character, the better. miR, microRNA; DAB1, disabled-1.

Figure 1. Bioinformatics reveals that Hsa-miR-300 affects PC progression by interacting with DAB1.

a, the heatmap of DEGs in GSE55945, with the X-axis referred to sample number and the Y-axis referred to gene name; the upper bars referred to sample type with blue color representing normal control samples and red color representing PC samples; the histogram on the right was the color gradation with red color representing high expression and blue color representing low expression; the upper dendrogram referred to the sample clustering and the dendrogram on the left referred to the gene expression clustering with one square representing the expression of one gene in one sample; b, the expression of DAB1 in PC samples and normal control samples of TCGA database, with the X-axis referred to sample number and the Y-axis referred to expression of DAB1; the blue box plot on the left referred the expression of DAB1 in normal control samples, and the red box plot on the right referred the expression of DAB1 in PC sample; c, the predicted miRNAs that regulated DAB1, with blue color representing the predicted results of microRNA.org database, the red color representing the predicted results of TargetScan database and green color representing the predicted results of mirDIP database, and the central sections referred to the intersection of the predicted miRNAs of the three databases. d, expression of hsa-miR-381-3p, hsa-miR-300, hsa-miR-186-5p, hsa-miR-29a-3p, and hsa-miR-149-5p in prostate cancer using RT-qPCR. Statistical data were measurement data and described as the mean ± standard deviation; data between two groups were analyzed by unpaired t-test; * p < 0.05, compared with BPH tissues. n for control = 62 and n for PC = 40.

Figure 2. miR-300 targets DAB1 and exhibits an important role in the progression of PC tissues indicated by dual-luciferase reporter gene assay, immunohistochemistry, and RT-qPCR

a, immunohistochemical staining of DAB1 in BPH tissues and PC tissues (× 400); b, the positive rate of DAB1 protein expression in BPH tissues and PC tissues. Positive rates of PC tissues and adjacent normal tissues were analyzed by the chi-square test; c, miR-300 expression and the mRNA expression of DAB1 in BPH tissues and PC tissues. Paired t test was used to compare the data of BPH tissues and PC tissues; d, Pearson correlation analysis between DAB1 and miR-300 expression in PC tissues. e, the predicted binding site of miR-300 in DAB1 3′UTR; F, detection of the luciferase activity of DAB1-wt and DAB1-mut in the NC and miR-300 mimic groups by dual-luciferase reporter gene assay. Statistical data were measurement data and described as the mean ± standard deviation; data between two groups were analyzed by unpaired t-test; n for BPH tissues = 62 and n for PC tissues = 40; * p < 0.05, compared with BPH tissues or the NC group.

Table 4. The relationship between miR-200 and pathological characteristics of patients with PC

Pathological characteristics		n	miR-200 expression	p value
Age	< 60	9	3.143 ± 0.452	P = 0.367
	≥ 60	31	3.286 ± 0.411
Gleason score	High (2–4)	13	2.818 ± 0.285	P < 0.0001
	Moderate (5–7)	7	3.164 ± 0.071
	Low (8–10)	20	3.569 ± 0.245
TNM stage	I-II	17	3.025 ± 0.320	P = 0.0016
	III-IV	23	3.424 ± 0.397
PSA expression (ng/mL)	< 10	18	3.115 ± 0.434	P = 0.473
	10–20	16	3.295 ± 0.417
	> 20	6	3.202 ± 0.412
Lymph node metastasis	Yes	18	3.492 ± 0.287	P = 0.0005
	No	22	3.059 ± 0.402

PC, prostatic cancer; miR-200, microRNA-200; TNM, tumor, node, metastases stage; PSA, prostate specific antigen.

Figure 3. RT-qPCR and Western blot analysis reveals that down-regulated miR-300 reduces the expression of RAC1, MMP2, MMP9, CyclinD1, and CyclinE, but elevate the level of DAB1 and Rap1

PC-3 cells were treated with miR-300 mimic/inhibitor and/or siRNA-DAB1. a, relative miR-300 expression and mRNA expression of DAB1, Rap1, RAC1, MMP2, MMP9, CyclinD1, and CyclinE in PC-3 cells determined by RT-qPCR; b, the protein expression of DAB1, Rap1, RAC1, MMP2, MMP9, CyclinD1, and CyclinE detected by western blot analysis; c, relative miR-300 expression and mRNA expression of DAB1, Rap1, RAC1, MMP2, MMP9, CyclinD1, and CyclinE in LNCap cells determined by RT-qPCR; d, the protein expression of DAB1, Rap1, RAC1, MMP2, MMP9, CyclinD1, and CyclinE in LNCap cells detected by western blot analysis. Statistical data were measurement data and described as mean ± standard deviation; one-way ANOVA was used for multi-group comparisons. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups; #, p < 0.05 compared with the miR-300 inhibitor or siRNA-DAB1 groups.

Figure 4. Down-regulated miR-300 decreases the adhesion of PC cells by targeting DAB1.

PC-3 or LNCap cells were treated with miR-300 mimic/inhibitor and/or siRNA-DAB1. a, PC-3 cell adhesion evaluated by adhesion assay; b, LNCap cell adhesion evaluated by adhesion assay. Statistical data were measurement data and described as mean ± standard deviation; one-way ANOVA was used for multi-group comparisons. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups.

Figure 5. MTT and EdU assay reveals that the up-regulation of miR-300 or DAB1 silencing can enhance cell proliferation, while inhibition of miR-300 suppresses the proliferation of PC cells

a, PC-3 cell viability tested by MTT assay; b, LNCap cell viability tested by MTT assay; c, PC-3 cell proliferation tested by EdU assay; d, LNCap cell proliferation tested by EdU assay. Statistical data were measurement data and described as mean ± standard deviation; two-way ANOVA was applied for data comparison at different time points. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups. #, p < 0.05 compared with the siRNA-DAB1 group.

Figure 6. Scratch test indicates that down-regulated miR-300 suppresses the migration of PC cells upon treatment with miR-300 mimic/inhibitor and/or siRNA-DAB1.

a, the relative migration ability of PC-3 cells in each group; b, the relative migration ability of LNCap cells in each group. Statistical data were measurement data and described as mean ± standard deviation; one-way ANOVA was used for multi-group comparisons. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups. #, p < 0.05 compared with the siRNA-DAB1 group.

Figure 7. Transwell assay reveals that down-regulated of miR-300 reduces the invasion of PC cells by up-regulating DAB1.

PC-3 or LNCap cells were treated with miR-300 mimic/inhibitor and/or siRNA-DAB1. a, PC-3 cell invasion in Transwell chambers in each group (× 200); b, LNCap cell invasion in Transwell chambers in each group (× 200). Statistical data were measurement data and described as mean ± standard deviation. One-way ANOVA was used for multi-group comparisons. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups. #, p < 0.05 compared with the siRNA-DAB1 group.

Figure 8. Flow cytometry assay revealed that down-regulated miR-300 reduces cell cycle and promotes apoptosis by up-regulating DAB1 expression

PC-3 or LNCap cells were treated with miR-300 mimic/inhibitor and/or siRNA-DAB1. a, PC-3 cell cycle percentage in each group; b, LNCap cell cycle percentage in each group; c, apoptosis of PC-3 cells determined by Annexin-V-FITC/PI dual staining; d, apoptosis of LNCap cells determined by Annexin-V-FITC/PI dual staining. Statistical data were measurement data and described as mean ± standard deviation. One-way ANOVA was used for multi-group comparisons. The experiment was repeated 3 times independently; *, p < 0.05 compared with the blank or NC groups. #, p < 0.05 compared with the siRNA-DAB1 group.

Figure 9. The molecular mechanism involved miR-300 targeting DAB1 in PC. MiR-300 inhibited the expression of DAB1 so that the expression of RAC1, MMP2, MMP9, CyclinD1, and CyclinE was increased. Down-regulated miR-300 suppressed proliferation, adhesion, migration, invasion, and cell cycle, but promoted apoptosis of PC cells. While down-regulation of miR-300 could reverse the above tendency and provided a therapeutic target for PC