Mesenchymal stem cell-derived exosomes containing miR-145-5p reduce inflammation in spinal cord injury by regulating the TLR4/NF-κB signaling pathway

Figures & data

Table 1. Primers used in real-time PCR analysis

Gene	Primer sequence
miR-145-5p	Forward: 5ʹ-GTCCAGTTTTCCCAGGAATCCC-3ʹ reverse: 5ʹ- TGTCGTGGAGTCGGCAATTG −3’
TLR4	Forward:5ʹ- GTCATGCTTTCTCACGGCCT-3ʹ reverse:5ʹ-AATTGTCTCAATTTCACACCTGGAT-3’
β-actin	Forward:5ʹ- GTGACGTTGACATCCGTAAAGA −3ʹ reverse: 5ʹ- GCCGGACTCATCGTACTCC −3’
U6	Forward:5ʹ- GCTTCGGCAGCACATATACTAA −3ʹ reverse: 5ʹ- CGAATTTGCGTGTCATCCTT −3’
P65	Forward:5ʹ- CGTTCGAGCAAATCCAGAAAGTG-3ʹ reverse: 5ʹ- AGGAACTCACTGGCTCCTTC −3’
IκBα	Forward:5ʹ- AACAACCTGCAGCAGACTCC-3ʹ reverse: 5ʹ- CACAATAGAATGCTCGGGGC-3’

Figure 1. The identification of EXs around MSCs and the expression level of miR-145-5p were detected in MSC-EXs

(a) After MSCs were successfully isolated and cultured, the formation of EXs was analyzed by transmission electron microscopy and nanometer scale. (b) EXs were identified by Western blotting to detect the expression of CD63 and CD9. (c) MiR-145-5p NC and miR-145-5p mimic were transfected into MSCs separately, and qRT-PCR was used to detect the expression level of miR-145-5p in MSC-EXs of each group (n = 3, ***P < 0.001, vs. EX-miR-NC)

Figure 2. MSC-EXs (EX) containing miR-145-5p improved functional recovery and reduced histopathological injury in SCI rats

(a) The BBB score was used to evaluate the hind limb function recovery of rats. (b) The rat spinal cord tissue was collected 28 days after the operation for HE staining and histopathological observation. (c) The rat spinal cord tissue was collected 28 days after the operation for Nissl staining. ELISA was used to detect the expressions of inflammatory factors TNF-α (d), IL-1β (E) and IL-6 (f) in spinal cord tissue, and to explore the effect of MSC-EXs on the inflammation of SCI rats. (n = 3, ***P < 0.001, vs. Sham group; ^###P < 0.001, vs. Model+EX-miR-NC group; ^{^^}P < 0.01, ^{^^^}P < 0.001, vs. Model+PBS group)

Figure 3. MSC-EXs could promote the expression of miR-145-5p in spinal cord tissue and inhibit the activation of TLR4/NF- κB pathway in SCI rats

(a) QRT-PCR was used to detect the expression of miR-145-5p in injured spinal cord tissue of rats in the Sham, Model, Model+EX-miR-145-5p-NC, Model+PBS and Model+EX-miR-145-5p groups. (b) QRT-PCR and Western blot (c–f) were used to detect the expressions of TLR4, p-P65, p65, p-IκBα and IκBα in the spinal cord tissues of rats in each group. (n = 3, ***P < 0.001, vs. Sham group; ^#P < 0.05, ^###P < 0.001, vs. Model+EX-miR-NC group; ^{^^}P < 0.01, ^{^^^}P < 0.001, vs. Model+PBS group)

Figure 4. MSC-EXs could inhibit the effect of LPS inhibition ofon inhibiting miR-145-5p expression, cell viability and apoptosis in PC12 cells

(a) A cell injury model was constructed by treating PC12 cells with LPS. A fluorescence microscope was used to observe the changes in the uptake of fluorescently labeled EX by PC12 cells and the Control group. (b) QRT-PCR was used to detect the expression of miR-145-5p in PC12 cells. (c) MTT was used to detect the viability of PC12 cells treated with LPS. (d,e) Flow cytometry staining was used to detect cell apoptosis. (n = 3, ***P < 0.001, vs. Control group; ^###P < 0.001, vs. LPS+EX-miR-NC group; ^{^^}P < 0.01, ^{^^^}P < 0.001, vs. LPS group)

Figure 5. MSC-EXs inhibited LPS-induced inflammatory response and activation of the TLR4/NF-κB pathway in PC12 cells

ELISA was performed to detect the contents of TNF-α (a), IL-1β (b) and IL-6 (c) in the cell supernatant. QRT-PCR (d) and Western blot (E-H) were used to detect the expression levels of TLR4, p-P65, P65, p-IκBα and IκBα in the cells. (***P < 0.001, vs. Control group; ^##P < 0.01, ^###P < 0.001, vs. LPS+EX-miR-NC group; ^{^^^}P < 0.001, vs. LPS group)

Figure 6. MiR-145-5p could specifically target TLR4 and inhibit TLR4 expression

(a) The target gene prediction databse TargetScan 7.1 was used to predict the target relationship between miR-145-5p and TLR4. (b) The dual luciferase assay was used to further verify the targeting relationship between miR-145-5p and TLR4. (n = 3,^ΔΔΔP<0.001, vs. miR-NC group)

Figure 7. MiR-145-5p inhibited TLR4 expression and TLR4 overexpression significantly reversed the protective effect of EX-miR-145-5p on PC12 cell viability, inhibition of apoptosis

(a,b) Western blot was used to detect the expression of TLR4 in cells. (c) QRT-PCR was used to detect the expression of TLR4 in cells. (d) MTT was used to detect the viability of PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (e,f) Flow cytometry was used to detect the apoptosis of PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (n = 3, ***P < 0.001, vs. LPS group; ^{^^^}P < 0.001, vs. LPS+EX-miR-NC group)

Figure 8. TLR4 overexpression significantly reversed the effect of EX-miR-145-5p on inhibiting inflammatory response and activating TLR4/NF- κB pathway in PC12 cells

(a) ELISA was used to detect TNF-α expression in PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (c) ELISA was used to detect IL-1β expression in PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (c) ELISA was used to detect IL-6 expression in PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (d) The expressions of p65 and IκBα were detected by qRT-PCR in PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (e–h) The expressions of p65 and IκBα were detected by Western blot in PC12 cells transfected with miR-145-5p mimic and TLR4 overexpression vector. (n = 3, ***P < 0.001, vs. LPS group; ^{^^}P < 0.01, ^{^^^}P < 0.001, vs. LPS+EX-miR-NC group)