Changes in Gene Expression Induced by Carbamazepine and Phenytoin: Testing the Danger Hypothesis

Figures & data

TABLE 1 Real-time PCR conditions and primers for Cyp2c29, Gstmu1, and Hspa8

Program (Cyp2c29, Gstmu1, Hspa8)	# Cycles	Target temperature (°C)	Incubation time	Temperature transition (°C/sec)	Acquisition mode
Denaturation	1	95	10 min	20	None
PCR(Segment1)	45	95	10 sec	20	None
(Segment2)		58	5 sec	20	None
(Segment3)		72	19 sec	20	Single
Melt(Segment1)	1	95	0	20	None
(Segment2)		65	30 sec	20	None
(Segment3)		98	0	0.20	Cont
Cool	1	40	30 sec	20	None

Cyp2c29 primers: Sense primer: 5′ TTCGCTATGGATCTGGTCGTG; Anti-sense primer: 5′ CACAGGGTGAGCCTTTGGTT; Gstmu1 primers; Sense primer: 5′ CGTATGTTTGAGCCCAAGTGC; Anti-sense primer: 5′ GGTCAGGGAGCCAATGAAGAA. Hspa8 primers: Sense primer: 5′ GCGAAAGCACAAGAAAGACAT; Anti-sense primer: 5′ AAGAGCAGCAAATCCTGAACG. Gapdh primers: Sense primer: 5′ CCATCACCATCTTCCAGGAG; Anti-sense primer: 5′ CCTGCTTCACCACCTTCTTG.

TABLE 2 Selected mRNA changes in CBZ- and PHN-treated mice

		mRNA level change (Fold)
		CBZ		PHN
Accession no. (Gene name)	Description of genes	8 hr	24 hr	8 hr	24 hr	48 hr
NM_009997.1 (Cyp2a4)	Cytochrome P450, family 2, subfamily a, polypeptide 4	(1.7)	(5.6)	(1.4)	(1.5)	(1.8)
		1.37	8.05	1.00	1.57	2.56
		2.07	3.52	1.89	1.49	1.18
		1.67	5.22	1.23		1.66
						1.66
NM_009993.2 (Cyp1a2)	Cytochrome P450, family 1, subfamily a, polypeptide 2	(1.7)	(2.2)	(1.5)	(2.1)	(1.6)
		1.13	2.47	1.17	2.19	1.40
		2.16	1.41	1.54	1.97	1.23
		1.78	2.73	1.70		1.73
						1.96
NM_007815.2 (Cyp2c29)	Cytochrome P450, family 2, subfamily c, polypeptide 29	(5.0)	(7.1)	(3.2)	(5.0)	(4.0)
		3.17	8.68	3.02	5.01	4.11
		6.76	5.43	3.57	4.94	3.59
		5.06	7.22	2.96		3.53
						4.86
NM_009999.2 (Cyp2b10)	Cytochrome P450, family 2, subfamily b, polypeptide 10	(8.0)	(6.8)	(5.7)	(7.1)	(6.3)
		3.10	5.61	5.94	7.09	5.03
		9.95	5.10	5.46	7.02	4.52
		10.9	9.67	5.62		9.79
						5.85
NM_010358.2 (Gstm1)	Glutathione S-transferase, mu 1	(2.5)	(5.0)	(1.2)	(2.5)	(3.4)
		2.27	5.55	−1.20	1.71	4.62
		2.01	3.95	1.47	3.33	2.12
		3.14	5.42	1.42		3.48
						3.20
NM_008181.2 (Gsta1)	Glutathione S-transferase, alpha 1 (Ya)	(−1.1)	(1.8)	(1.0)	(1.4)	(1.2)
		1.01	2.80	−1.09	1.36	1.17
		−1.27	1.58	1.14	1.39	1.23
		1.03	−1.01	1.06		1.38
NM_010356.2 (Gsta3)	Glutathione S-transferase, alpha 3	(1.0)	(1.6)	(1.0)	(91.3)	(1.3)
		1.02	1.33	−1.02	1.47	1.36
		−1.10	2.02	−1.01	1.05	1.50
		1.04	1.41	1.03		1.24
						1.13
NM_008185.2 (Gstt1)	Glutathione S-transferase, theta 1	(1.1)	(1.4)	(1.0)	(1.4)	(1.5)
		1.15	1.06	1.01	1.79	1.29
		1.06	1.98	1.03	1.05	1.83
		1.15	1.29	1.12		1.48
						1.31
(Dgcr2)	Glutathione S-transferase, pi 2	(1.3)	(3.5)	(−1.1)	(1.8)	(1.6)
		1.37	5.07	−1.13	1.43	1.56
		1.50	4.19	−1.11	2.15	1.16
		−1.08	1.11	−1.10		1.76
						1.99
NM_031165.3 (Hspa8)	Heat shock protein 8	(1.6)	(2.3)	(1.1)	(1.6)	(1.2)
		2.00	2.63	1.08	1.46	1.46
		1.63	2.66	1.08	1.81	1.28
		1.15	1.47	1.06		1.09
						1.14
NM_022310.2 (Hspa5)	Heat shock 70kD protein 5 (glucose-regulated protein)	(1.6)	(1.3)	(−1.2)	(1.3)	(1.2)
		1.27	−1.15	−1.04	−1.89	2.03
		1.79	1.53	−1.92	2.48	1.02
		1.82	1.37	1.23		−1.07
						−1.17
NM_010480.3 (Hspca)	Heat shock protein 1, alpha	(1.6)	(2.1)	(−1.1)	(1.4)	(1.2)
		1.92	1.82	1.07	1.32	1.39
		1.37	2.62	−1.44	1.45	−1.28
		1.56	1.97	1.02		1.13
						1.22
NM_010477.2 (Hspd1)	Heat shock protein 1 (chaperonin)	(1.2)	(1.5)	(−1.1)	(1.3)	(1.1)
		1.23	1.36	−1.04	1.02	1.37
		1.15	1.42	−1.10	1.49	1.14
		1.14	1.57	−1.02		1.16
						1.09
NM_008303.2 (Hspe1)	Heat shock protein 1 (chaperonin 10)	(1.1)	(1.4)	(−1.1)	(1.4)	(1.1)
		1.16	1.37	−1.21	1.22	1.22
		1.11	1.39	−1.15	1.55	−1.10
		1.09	1.51	−1.00		1.31
						1.12
NM_013467.1 (Aldh1a1)	Aldehyde dehydrogenase family 1, subfamily A1	(1.3)	(1.5)	(1.1)	(1.5)	(1.5)
		−1.13	1.71	−1.03	1.33	2.29
		1.26	−1.23	1.10	1.56	−1.05
		1.64	2.01	1.21		1.55
						1.40
NM_011921.1 (Aldh1a7)	Aldehyde dehydrogenase family 1, subfamily A7	(1.3)	(1.6)	(1.1)	(1.3)	(1.4)
		1.04	1.48	−1.05	1.24	1.54
		1.48	1.33	1.25	1.39	1.36
		1.36	1.84	1.18		1.40
						1.34
NM_008898.1 (Por)	P450 (cytochrome) oxidoreductase	(3.6)	(3.4)	(3.3)	(3.6)	(4.4)
		2.45	3.57	3.23	3.76	4.84
		5.02	1.94	3.54	3.48	3.48
		3.27	4.57	3.21		5.67
						3.63
NM_011318.1 (Apcs)	Serum amyloid P-component	(1.5)	(−1.3)	(1.3)	(1.2)	(2.9)
		2.28	−1.44	1.73	−1.26	2.91
		1.05	−1.03	−1.05	1.71	5.26
		1.21	−1.30	1.21		2.20
						1.27
NM_013701.1 (Ugt1a2)	UDP glucuronosyltransferase 1 family, polypeptide A2	(1.3)	(1.6)	(1.2)	(1.4)	(2.1)
		1.24	1.58	−1.01	1.53	2.30
		1.22	1.56	1.29	1.33	2.00
		1.43	1.80	1.24		2.20
						1.72
NM_153598.1 (Ugt2b34)	UDP glucuronosyltransferase 2 family, polypeptide B34	(2.2)	(1.9)	(1.8)	(1.9)	(1.9)
		1.68	2.01	1.90	1.75	2.24
		2.44	1.27	1.74	1.98	1.48
		2.55	2.41	1.76		1.93
						1.94

Shaded genes are Keap1-Nrf-2 dependent in mouse liver (Kwak et al., 2003). Other genes in this table are also closely related to Nrf-2 dependent genes. In particular, heat shock protein 8 and UDP glucuronosyltransferase 2 family, polypeptide B34 are likely analogous to heat shock protein, 84 kDa 1 and UDP glucuronosyltransferase 2 family, member 5, respectively from Kwak et al. (2003). The values are relative to control animals and the values in parentheses are the mean of the individual values reported below the means.

TABLE 3 Real-time PCR of Cyp2c29, Gstmu1, and Hspa8 mRNA levels in CBZ-treated mouse liver

	mRNA level (relative to GAPDH)
	8 hour		24 hour
Gene name	Control (n = 3)	CBZ-Treated (n = 4)	Control (n = 3)	CBZ-Treated (n = 4)
Cyp2c29	0.46 ± 0.054	3.30 ± 0.76	0.47 ± 0.090	5.80 ± 1.50
Gstmu1	0.67 ± 0.11	1.37 ± 0.23	0.71 ± 0.046	3.70 ± 0.75
Hspa8	0.17 ± 0.018	0.44 ± 0.066	0.27 ± 0.051	0.68 ± 0.15

*Different than control with p < 0.01 using the student test.

Kwak M. K., Wakabayashi N., Itoh K., Motohashi H., Yamamoto M., Kensler T. W. Modulation of gene expression by cancer chemopreventive dithiolethiones through the Keap1-Nrf2 pathway. Identification of novel gene clusters for cell survival. J. Biol. Chem. 2003; 278: 8135–8145

 PubMed Web of Science ®Google Scholar