Analysis of hematologic alterations, immune responses and metallothionein gene expression in Nile tilapia (Oreochromis niloticus) exposed to silver nanoparticles

Figures & data

Table 1. Oligonucleotide primers used for quantitative real-time RT-PCR (Thummabancha et al. 2016).

Target gene	Accession number	Primer name	Sequence (5′ to 3′)	Purpose	Amplicon size (bp)
Beta-actin	XM_003443127	Beta-actin F	ACAGGATGCAGAAGGAGATCACAG	Real-time PCR	155
		Beta-actin R	GTACTCCTGCTTGCTGATCCACAT	Real-time PCR
Metallothionein	XM_003447045	MT F	GCCAAGACTGGAACCCGCAACTGC	Real-time PCR	136
		MT R	TTCCTTTGCACACGCAGCCAGAGG	Real-time PCR

Figure 1. Relative expression ratios of MT gene in Nile tilapia. (a) Liver. (b) spleen. (c) anterior kidney. Values shown are means ± SD. At each given timepoint, bars with different lettering significantly differ from one another at p < 0.05. N = 3 fish/group/timepoint.

Table 2. Hematocrit levels in fish.

	%Hematocrit
Experimental group	1st wpi	2nd wpi	4th wpi	6th wpi	8th wpi
0.85% NaCl	28.30 ± 1.53^a	26.70 ± 1.53^a	26.70 ± 1.53^a	28.70 ± 1.15^a	28.00 ± 1.00^a
1 mg Ag NPs/kg fish	26.70 ± 2.08^a	19.30 ± 1.15^c	16.00 ± 1.00^c	19.30 ± 1.15^c	19.7 ± 0.58^c
100 mg Ag NPs/kg fish	19.30 ± 1.15^b	23.00 ± 2.00^b	21.00 ± 2.00^b	25.30 ± 0.58^b	22.00 ± 1.00^b

In each column, values with superscripts that differ are significantly different at p < 0.05.

Table 3. Red blood cell counts in fish.

	Red blood cell count (×10^6/mm^3)
Experimentalgroup	1st wpi	2nd wpi	4th wpi	6th wpi	8th wpi
0.85% NaCl	1.68 ± 0.28^a	1.60 ± 0.20^a	1.65 ± 0.14^a	1.69 ± 0.06^a	1.66 ± 0.12^a
1 mg Ag NPs/kg fish	0.96 ± 0.30^b	1.75 ± 0.13^a	1.50 ± 0.27^ab	1.45 ± 0.10^b	1.45 ± 0.10^b
100 mg Ag NPs/kg fish	0.57 ± 0.33^b	1.02 ± 0.11^b	1.27 ± 0.05^b	1.49 ± 0.11^b	1.49 ± 0.14^b

In each column, values with superscripts that differ are significantly different at p < 0.05.

Table 4. Total white blood cell levels in fish

	Total white blood cell count (×10^4/mm^3)
Experimental group	1st wpi	2nd wpi	4th wpi	6th wpi	8th wpi
0.85% NaCl	14.67 ± 0.15^a	12.25 ± 0.25^a	11.25 ± 0.17^a	11.25 ± 0.35^a	11.50 ± 0.19^a
1 mg Ag NPs/kg fish	13.33 ± 0.12^a	10.25 ± 0.24^a	10.00 ± 0.23^a	10.25 ± 0.15^a	10.75 ± 0.34^a
100 mg Ag NPs/kg fish	10.25 ± 0.10^b	12.25 ± 0.25^a	10.75 ± 0.13^a	10.25 ± 0.19^a	10.25 ± 0.26^a

In each column, values with superscripts that differ are significantly different at p < 0.05.

Figure 2. Functionality of isolated phagocytes. (a) Phagocytic activity (PA). (b) Phagocytic index (PI). (c) Phagocytic efficiency (PE). Cells (from all peripheral blood leukocytes) were isolated from tilapia exposed to 1 or 100 mg AgNP/kg at 1st, 2nd, 4th, 6th and 8th wpi. Values shown are means ± SD. At each given timepoint, bars with different lettering significantly differ from one another at p < 0.05. N = 3 fish/group/timepoint.

Figure 3. Antibody titer levels in tilapia immunized with vaccine (FASA) and exposed to various doses of AgNP. Values shown are means ± SD. At each given timepoint, bars with different lettering significantly differ from one another at p < 0.05. N = 3 fish/group/timepoint.

Figure 4. Cumulative mortality (%) in tilapia with/without AgNP exposure and then challenged with S. agalactiae. Fish that not exposed to AgNP served as control for infections. Values shown are means ± SD. At given timepoint, bars with different lettering significantly differ from one another at p < 0.05. N = 3 fish/group/timepoint.

Figure 5. Cumulative mortality (%) in FASA-vaccinated tilapia with and without AgNP exposure and then challenged with S. agalactiae. Fish that were not immunized with FASA or then exposed to AgNP served as control for infections. Values shown are means ± SD. At each given timepoint, bars with different lettering significantly differ from one another at p < 0.05. N = 3 fish/group/timepoint.

Thummabancha K, Onparn N, Srisapoome P. 2016. Molecular characterization and expression analyses of cDNAs encoding the thioredoxin-interacting protein and selenoprotein P genes and histological changes in Nile tilapia (Oreochromis niloticus) in response to silver nanoparticle exposure. Gene. 577:161–173.

 PubMed Web of Science ®Google Scholar