Hsa_circ_0044235 and hsa_circ_0001947 as novel biomarkers in plasma of patients with new-onset systemic lupus erythematosus

Figures & data

Table 1. Specific circRNA primers used for RT-qPCR analysis.

circRNA	Primer sequence (F)	Primer sequence (R)
hsa_circ_0104871	CGGAACTTCCTGTGGTCATCT	TCCATCTCAAGCAGGTTTCATT
hsa_circ_0008675	GGAAGCCTTGCAGTTTGCTC	AGCATTGGCTGGTGGGTTAT
hsa_circ_0082689	GTCCCCAAACACTCTTAGCCA	CACACTCAGGTTGTGTTCGG
hsa_circ_0082688	TGCCGTATCGATGGCAATTC	ATAGCTCAGGTGGTCAACGC
hsa_circ_0001947	ACACTCTTGGATGGAAAACCCA	CGTGTTCTGGACTCGGTTGG
hsa_circ_0001481	AGCAGGAGCTTCATCAACGAT	GATGTTGTGAACTGGCATGTGA
hsa_circ_0044235	TGAGTTTGGTGATTCAGCTTGC	AACAAGGCTTCTTCTGAGTGT
hsa_circ_0068367	TGTCTACAACAGAGGCATGAATGA	GCTGCAGCAGAAGGCAGTAA
hsa_circ_0000175	GCCCATTTTCCCCAGACCTAC	GGAACTGCCACAGGGTGATA
hsa_circ_0002316	AACCCAAGATGCCAGAATGGT	AGCAGCAGACTGCAATCCA
GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG

circRNA: circular RNA; F: forward; R: reverse.

Figure 1. Screening of differentially-expressed circRNA in plasma samples from 22 patients with SLE and 22 HC subjects. Expression levels of (A) hsa_circ_0000175 [Student’s t-test], (B) hsa_circ_0044235 [Mann–Whitney U-test], and (C) hsa_circ_0068367 [Mann–Whitney] were significantly down-regulated in patients with SLE (compared with those noted in HC subjects). (D) Expression levels of hsa_circ_0002316 exhibited no significant differences between patients with SLE and HC subjects (Mann–Whitney). (E) Expression levels of hsa_circ_0104871 exhibited no significant differences between patients with SLE and HC subjects (Mann–Whitney test). (F) Expression levels of hsa_circ_0001947 were significantly down-regulated in patients with SLE compared with those noted in HC subjects (Mann–Whitney). (G) No differences in hsa_circ_0001481 expression levels between SLE and HC subjects (Student’s t-test). circRNA/circ = circular RNA. HC = healthy control. SLE = systemic lupus erythematosus.

Table 2. Clinical parameters in the patients in this study.

Category	SLE (n = 65)	HC (n = 51)	RA (n = 51)
Females [% (n/total n)]	90.77 (59/65)	92.16 (47/51)	76.47 (39/51)
Age (years)	34.45 ± 14.10	39.22 ± 12.31	^&54.65 ± 14.94
SLEDAI score	12.07 ± 6.80	–	–
Anti-dsDNA, % (n/total n)	52.31 (34/65)	–	–
Anti-ENA [all % and (n/total n)]
Anti-Sm	26.98 (17/63)	–	–
Anti-Ro52	66.67 (42/63)	–	–
Anti-nRNP/Sm	47.62 (30/63)	–	–
Anti-rRNP	60.32 (38/63)	–	–
Anti-nucleosome	66.67 (42/63)	–	–
Anti-SSA	60.31 (38/63)	–	–
Anti-SSB	23.81 (15/63)	–	–
C3 (g/L)	0.56 ± 0.28	–	–
C4 (g/L)	0.13 ± 0.07	–	–
IgG (g/L)	18.51 ± 6.55	–	–
ESR (mm/hr)	56.28 ± 37.34	–	65.20 ± 36.74
CRP (mg/L)	12.49 ± 24.63	–	^&34.05 ± 38.80
WBC (10^9/L)	*5.07 ± 3.01	6.10 ± 1.28	^&7.46 ± 2.10
RBC (10^12/L)	*3.68 ± 1.08	4.53 ± 0.31	^&4.23 ± 0.52
HGB (g/L)	*100.05 ± 26.75	135.80 ± 9.97	^&117.02 ± 17.68
HCT (L/L)	*0.33 ± 0.13	0.41 ± 0.03	^&0.37 ± 0.05
PLT (10^9/L)	*178.34 ± 117.23	238.16 ± 47.98	^&307.73 ± 91.35
MPV (fL)	10.93 ± 1.45	10.91 ± 0.83	10.47 ± 1.47
PCT (%)	*0.22 ± 0.10	0.26 ± 0.06	^&0.32 ± 0.07
PDW (fL)	13.93 ± 3.11	13.12 ± 1.66	^&12.31 ± 3.81
L (10^9/L)	*1.07 ± 0.72	2.10 ± 0.55	^&1.69 ± 0.56
L (%)	*23.01 ± 10.34	34.95 ± 8.12	23.85 ± 8.73
M (10^9/L)	0.36 ± 0.21	0.39 ± 0.15	^&0.47 ± 0.20
M (%)	*8.30 ± 5.17	6.29 ± 1.79	^&6.32 ± 1.93
N (10^9/L)	3.60 ± 2.67	3.47 ± 1.02	^&5.17 ± 1.98
N (%)	*66.15 ± 16.17	56.47 ± 8.43	67.98 ± 9.62
PLR	*192.00 ± 137.27	119.60 ± 33.88	202.37 ± 93.69
NLR	*4.29 ± 4.49	1.81 ± 1.03	3.50 ± 2.10
LMR	*4.40 ± 5.70	6.03 ± 2.74	4.14 ± 2.15

All values are means ± SD. *p < 0.05 vs. HC, ^&p < 0.05 vs. SLE.

Anti-double-stranded DNA (Anti-dsDNA); Anti-extractable nuclear antigen (Anti-ENA); Antinuclear antibody (ANA); Anti-nuclear ribonucleoprotein/Smith antibody (Anti-nRNP/Sm); Anti-ribosome RNP antibody (Anti-rRNP); Anti-Smith antibody (Anti-Sm); Anti-Sjögren syndrome A antigen antibody (Anti-SSA); Anti-Sjögren syndrome B antigen antibody (Anti-SS-B); Complement 3 (C3); Complement 4 (C4); C-reactive protein (CRP); Erythrocyte sedimentation rate (ESR); Healthy controls (HC); Hematocrit (HCT); Hemoglobin (HGB); Immunoglobulin G (IgG); Lymphocyte count (L); Lymphocyte percentage (L%); Lymphocyte-Monocyte ratio (LMR); Monocyte count (M); Monocyte percentage (M%); Mean Platelet Volume (MPV); Neutrophil count (N); Neutrophil percentage (N%); Neutrophil-lymphocyte ratio (NLR); plateletcrit (PCT); platelet distribution width (PDW); Platelet count (PLT); Platelet-lymphocyte ratio (PLR); Rheumatoid arthritis (RA); Red blood cell count (RBC); Systemic lupus erythematosus (SLE); SLE disease activity index (SLEDAI); White blood cell count (WBC).

Figure 2. Validation of expression levels of hsa_circ_0000175, hsa_circ_0044235, hsa_circ_0068367 and hsa_circ_0001947 in plasma samples during the second stage. (A) In plasma samples from 65 patients with SLE. expression levels of (A) hsa_circ_0000175 [Student’s t-test], (B) hsa_circ_0044235 [Mann–Whitney U-test], (C) hsa_circ_0068367 [Mann–Whitney], and (D) hsa_circ_0001947 [Student’s t-test] were significantly down-regulated compared with those in samples from 51 HC subjects. In plasma samples from 65 patients with SLE, expression levels of (E) hsa_circ_0000175 [Mann–Whitney], (F) hsa_circ_0044235 [Mann–Whitney], (G) hsa_circ_0068367 [Mann–Whitney], and (H) hsa_circ_0001947 [Mann–Whitney] in plasma samples from 65 patients with SLE were significantly down-regulated compared with those in samples from 51 patients with RA. SLE = systemic lupus erythematosus. HC = healthy control. RA = rheumatoid arthritis. circ = circular RNA.

Table 3. Expression of plasma hsa_circ_0000175, hsa_circ_0044235, hsa_circ_0068367 and hsa_circ_0001947 in the equation.

	B	S.E	Wald	df	p-Value	Exp (B)
hsa_circ_0000175	–0.640	0.329	3.779	1	0.0520	0.527
hsa_circ_0044235	–1.507	0.425	12.548	1	<0.0001	0.222
hsa_circ_0068367	–0.177	0.192	0.857	1	0.3550	0.837
hsa_circ_0001947	–0.925	0.242	14.611	1	<0.0001	0.396
Constant	2.846	0.553	26.506	1	<0.0001	17.213

Figure 3. ROC curve analysis of plasma hsa_circ_0044235 and hsa_circ_0001947 expression levels in patients with SLE and HC. (A) ROC curve analyses of plasma (A) hsa_circ_0044235 and (B) hsa_circ_0001947 expression levels in SLE patients and HC subjects. (C) ROC curve analysis using combined plasma hsa_circ_0044235, and hsa_circ_0001947 expression levels in SLE patients and HC subjects. ROC = receiver operating characteristics. SLE = systemic lupus erythematosus. HC = healthy control. circ = circular RNA.

Table 4. ROC curve analysis of circRNA as SLE diagnosis from hosts in the RA and RA + HC groups.

Variables	AUC	SEM	p-Value	95% CI	Sensitivity	Specificity	Cut-off
SLE vs HC
hsa_circ_0044235	0.789	0.041	<0.0001	0.708–0.869	0.57	0.84	0.5113
hsa_circ_0001947	0.641	0.051	0.0092	0.541–0.742	0.46	0.80	0.6413
hsa_circ_0044235 + hsa_circ_0001947	0.800	0.040	<0.0001	0.721–0.878	0.88	0.55	–
SLE vs RA
hsa_circ_0044235	0.701	0.048	0.0002	0.607–0.795	0.63	0.71	0.5871
hsa_circ_0001947	0.854	0.035	<0.0001	0.785–0.923	0.85	0.75	1.5050
hsa_circ_0044235 + hsa_circ_0001947	0.883	0.031	<0.0001	0.823–0.943	0.77	0.88	–
SLE vs RA + HC
hsa_circ_0044235	0.745	0.039	<0.0001	0.669–0.821	0.57	0.80	0.5006
hsa_circ_0001947	0.748	0.038	<0.0001	0.673–0.822	0.85	0.55	1.5050
hsa_circ_0044235 + hsa_circ_0001947	0.829	0.032	<0.0001	0.767–0.890	0.69	0.78	–

AUC: Area under curve; HC: healthy controls; RA: rheumatoid arthritis; ROC: receiver operating characteristics; SLE: systemic lupus erythematosus.

Figure 4. ROC curve analysis of plasma hsa_circ_0044235 and hsa_circ_0001947 expression levels in patients with SLE and RA, RA + HC. ROC curve analysis of plasma (A) hsa_circ_0001947 and (B) hsa_circ_0044235 expression levels in patients with SLE and RA. (C) ROC curve analysis of combined plasma hsa_circ_0044235 and hsa_circ_0001947 expression levels in patients with SLE and RA. ROC curve analysis of plasma (D) hsa_circ_0001947 and (E) hsa_circ_0044235 expression levels in SLE and control subjects (patients with RA + HC subjects). (F) ROC curve analysis of combined plasma hsa_circ_0044235 and hsa_circ_0001947 expression levels in SLE and control subjects (patients with RA + HC subjects). ROC : receiver operating characteristics; SLE : systemic lupus erythematosus; RA : rheumatoid arthritis; HC : healthy control; circ : circular RNA.

Figure 5. Correlation of plasma hsa_circ_0044235 and hsa_circ_0001947 expression levels with clinical manifestations of SLE. (A) Plasma expression levels of hsa_circ_0044235 in patients with SLE were positively associated with PLT (Spearman’s method). (B) Plasma expression levels of hsa_circ_0044235 in patients with SLE were positively associated with PCT (Spearman’s method). (C) Plasma expression levels of hsa_circ_0044235 in patients with SLE were negatively associated with PDW (Spearman’s method). (D) No significant difference was noted in the plasma expression levels of hsa_circ_0044235 prior to and following treatment (Student’s t-test, paired t-test). (E) Plasma expression levels of hsa_circ_0001947 were increased in these patients with SLE following treatment (Mann-Whitney test, Wilcoxon matched-pairs test). SLE : systemic lupus erythematosus; PCT : platelet crit; PDW : platelet distribution width; PLT : platelet count.

Data availability statement

The data used to support the findings of the present study are available from the corresponding author on reasonable request.