Yin Yang 1 impacts upon preeclampsia by regulating T_reg/T_H17 cells and PI3K/AKT pathway

Figures & data

Table 1. Primer sequences used in the study.

Name of primer	Sequence (5′→3′)
Foxp3-F	CTGGAATCACGGTAGCTGGG
Foxp3-R	TGCTCTCCCCTACCAGATGT
RORC-F	CGAGGAAAGGACCAGGCTAC
RORC-R	GGGGTCAGAATGTGGACAGG
YY1-F	TCAGGTAGAGCCAGTTCCCT
YY1-R	ACCACACCACCTACACTTGC
GAPDH-F	GTGGCTGGCTCAGAAAAAGG
GAPDH-R	GGGGAGATTCAGTGTGGTGG

F: forward; R: reverse; GAPDH: glyceraldehyde phosphate dehydrogenase.

Table 2. Clinical data from patients in the control and PE groups.

	Control group	PE group
	(n = 23)	(n = 18)
Age	27.25 ± 2.60	28.15 ± 4.30
Gravidity	1.72 ± 0.82	1.82 ± 0.91
Blood drawn at gestational week	34.22 ± 2.10	34.06 ± 1.80
Systolic pressure (mm Hg)	118 ± 10.25	**158.00 ± 16.23
Diastolic pressure (mm Hg)	73.62 ± 6.20	*95.57 ± 6.23
Albuminuria (g/24 h)	——	1.53 ± 0.42
Fetus weight (g)	3316.00 ± 265.00	**2458.00 ± 523.00
Apgar scores in the 1st min	8.23 ± 1.56	**7.02 ± 2.03
Apgar scores in the 5st min	9.42 ± 1.43	**8.36 ± 2.41

All values shown are means ± SD. *p < 0.05, **p < 0.01 vs. control group.

Figure 1. Circulating T_reg and T_H17 cell levels in human subjects. (A and B) T_reg and T_H17 cells in blood (flow cytometry). (C and D) detection of T_reg cells in placental tissues (immunohistochemical staining). (E and F) Foxp3 and RORc mRNA and protein expression (RT-qPCR and Western blot analyses). **p < 0.01 vs. control group. Control group, n = 23; PE group, n = 18.

Figure 2. Inflammation response indices in the blood. (A-C) ELISA was used to measure select inflammatory cytokines in the peripheral blood. *p < 0.05, **p < 0.01 vs. control group. Control group, n = 23; PE group, n = 18.

Figure 3. Cell apoptosis in placental tissues. TUNEL staining was used to assess levels of cell apoptosis in all harvested human placental tissues. **p < 0.01 vs. control group. Control group, n = 23; PE group, n = 18.

Figure 4. Changes in trophoblast infiltration and spiral artery. (A) Changes in trophoblast infiltration and spiral artery. Spiral arteries: (B) without physiological and pathological changes (H&E, 200× magnification); (C) with physiological expansion (H&E, 200× magnification); or, (D) with pathological changes (H&E, 200× magnification). physiologically-altered spiral arteries (E) with trophoblast infiltration (immunohistochemical staining, 400× magnification) or (F) without trophoblast infiltration (immunohistochemical staining, 400× magnification). trophoblasts appear brownish yellow.

Table 3. Depth of trophoblast infiltrating membrana serotina and superficial myometrium of placenta bed.

Group	n	Membrana serotina				Superficial myometrium of the uterus
		≤1/2		>1/2		Junction		1LPF		2LPF		3LPF
		n	%	n	%	n	%	n	%	n	%	n	%
Control	23	23	100	23	100	21	91	20	87	16	70	15	65
PE	18	18	100	17	94	13	72*	10	56*	5	28**	3	17**

1LPF: one low-power field; 2LPF: two low-power field; 3LPF: three low-power field.

*p < 0.05, **p < 0.01 vs. control group.

Table 4. Density of trophoblast infiltrating membrana serotina and superficial myometrium of placenta bed.

Group	n	Membrana serotina		Superficial myometrium of the uterus
		≤1/2	>1/2	Junction	1LPF	2LPF	3LPF
Control	23	22.32 ± 6.35	20.46 ± 5.25	19.24 ± 4.28	15.88 ± 3.65	10.45 ± 2.24	5.24 ± 1.26
PE	18	21.26 ± 7.16	*15.32 ± 4.16	**10.25 ± 4.46	**4.16 ± 1.68	**2.13 ± 0.42	**0.89 ± 0.26

1LPF: one low-power field; 2LPF: two low-power field; 3LPF: three low-power field.

*p < 0.05, **p < 0.01 vs. control group.

Table 5. Lumen area and wall thickness of spiral artery in placental bed.

Group	n	Membrana serotina		Superficial myometrium of uterus
		Lumen area	Wall thickness	Lumen area	Wall thickness
Control	23	176.23 ± 42.16	88.24 ± 11.31	120.16 ± 31.45	92.16 ± 15.46
PE	18	**134.21 ± 31.15	*110.56 ± 16.15	**65.25 ± 21.42	**137.85 ± 18.26

Lumen area in µm²; wall thickness in µm.

All values shown are means ± SD. *p < 0. 05, **p < 0. 05 vs. control group.

Figure 5. Over-expression of YY1 and the PE process. RT-qPCR and Western blot analysis were used to determine YY1 (A) mRNA and (B) protein expression in human placental samples. (C) Linear correlation analysis of the correlation between YY1 and Foxp3 expression in PE patient placental tissues. RT-qPCR and Western blot analyses were used to determine YY1 (D) mRNA and (E) protein expression in rat placental tissues. (F) Blood pressure in rats. (G) Rat urinary protein content. (H-J) Blood inflammatory cytokines (ELISA). N = 6/group. *p  <  0.05, ** p  <  0.01 vs. sham group; #p  <  0.05 vs. control group.

Table 6. Pregnancy-related indicators in rat hosts.

Group (n = 6/group)	Mean number born	Absorbent fetuses	Pup weight (mg)
Sham group	15.26 ± 0.51	0	2325.00 ± 22.56
PE model group	14.82 ± 0.34	4	*1954.00 ± 31.26
OE-YY1 group	15.44 ± 0.19	0	2218.00 ± 32.55

All values shown are means ± SD. *p < 0.05 vs. sham group.

Figure 6. Over-expression of YY1 inhibits the PE process. Levels of (A) T_H17 and (B) T_reg cells (flow cytometry). Foxp3 and RORc (C) mRNA and (D) protein expression (RT-qPCR and Western blot analyses). *p  <  0.05, **p  <  0.01 vs. sham or control group. N = 6/group.

Figure 7. YY1 activates the PI3K/AKT pathway. Expression of PI3K/AKT pathway-related proteins in placental tissues (Western blot). *p  <  0.05, **p  <  0.01 vs. sham group. N = 6/group.