Development of Subgenome-Specific Markers for FaRXf1 Conferring Resistance to Bacterial Angular Leaf Spot in Allo-Octoploid Strawberry

Figures & data

Figure 1. Physical locations of nine IStraw90 Axiom® array SNP markers in octoploid reference genome sequence (cv. Camarosa). The FaRXf1 genomic region (598 kb) is marked in the chromosome Fvb6–2, and subgenome-specific SNPs are highlighted in gray

Table 1. List of the IStraw90 Axiom® array probes and sequences for FaRXf1 mapped to the reference genome ‘Camarosa’. The forward and reverse primer for each SNP probe are underlined. ‘Camarosa’ Chromosome 6–2 subgenome-specific SNPs are highlighted in gray

SNP probe ID^z	Probe sequence^y
AX-89898263	CCAAACGGAACT[T/C]GGATTTATAAGAAGTTAATGCAGTT[C/T]ATGGAAAAGGAGTATCTGAAAAGAGGATATCAGGAGGTT
AX-89798107	GGTCAATGATTCAAATGTAAGATAGAGGTTCAACCTTTTTGAC[A/G]GTTCATCTTGTTGTCTATGAC[A/T]GGTTCATCTGATA
AX-89840981	AACTGATCGAGAGATGATAAAGTTTTCATGTCATC[G/A]GGAGGAAAGTAACTAGCCGCCTTTCCCATTAGGGA
AX-89798089	CAAAGATCTGCATTCGATTCCTATCAAAGCAGAAC[G/T]TTCCATGGAGCCCGAGTGGCTTTCCTCTGCAAAGG
AX-89810614	GGATTTGATAGAAGCTTCCGAAGGCCCTAAGGATC[C/T]CAACACCCCACCATTTAATGCTTCTGCCACCACTC
AX-89798073	TTTTTCCCAAGTGTCCTGTCATTGATGACCTTGTT[G/T]CTTCTCGAGCTCAGAAA[T/C]AATATTCGATCACCAAGGTC
AX-89898194	CAAGCACGAACAACATCAGCATCAGAAACTCGATA[G/A]ACTAACTTGGTTATCTCATACATTATTGCATAGGC
AX-89898137	GTTCCCCGAGACTCAATTCGAGGCACCTTCGAGCT[G/A]ACTCTCGCATTCATCC[G/A]ATCACTCAGAAGGAGTGT
AX-89840851	AGTGTGTAGTTCATCCGATAGTTAAAGTTTGTAAC[T/C]GTAACCTTCACACGCCAGTACTCCTTGTAATTCAC

^zIStraw90K Axiom® SNP probe set IDs assigned by Affymetrix, Inc (Bassil et al. 2015).

^yTarget SNP alleles interrogated by probes.

Figure 2. HRM analysis of HRM6D_33.083 marker and two subgenome-specific markers, Xf1HRM-8073 and Xf1HRM-8263, associated with FaRXf1 using CTAB purified DNA. (A) HRM analysis result of HRM6D_33.083 marker with 384 breeding accessions in the 2017 HTP-MAS program; (B) and (C) HRM analysis results of Xf1HRM-8073 (B) and Xf1HRM-8263 (C) markers with 14 accessions (K08-17, K12-10, 13.77–5, 13.78–157, 14.100–58, 14.100–59, 14.101–154, 14.101–200, 14.101–225, ‘Florida Brilliance’, ‘Florida Radiance’, ‘Strawberry Festival’, Sweet Sensation® ‘Florida127ʹ, and ‘Treasure’). The blue and green curves indicate resistance and red curve indicates susceptibility

Table 2. Subgenome specific-marker validation of Xf1HRM-8073 and Xf1HRM-8263 markers in five varieties and 51 UF advanced accessions using CTAB purified DNA and NaOH crude extracts

		CTAB purified DNA		NaOH crude extract
Accession	Phenotype	Xf1HRM-8073	Xf1HRM-8073	Xf1HRM-8073
Florida Brilliance	S	S	S	S
Florida Radiance	S	S	S	S
Strawberry Festival	S	S	S	S
Sweet Sensation® ‘Florida 127’	S	S	S	S
Treasure	S	S	S	S
13.19–86	S	S	S	S
13.27–142	S	S	S	S
13.46–88	S	S	S	S
14.34–33	S	S	S	S
14.37–103	S	S	S	S
14.55–48	S	S	S	S
14.61–80	S	S	S	S
14.9–29	S	S	S	S
15.21–98	S	S	S	S
15.25–6	S	S	S	S
15.29–152	S	S	S	S
15.42–52	S	S	S	S
15.56–134	S	S	S	S
15.74–11	S	S	S	S
15.89–25	S	S	S	S
16.2–163	S	S	S	S
16.28–85	S	S	S	S
16.30–128	S	S	S	S
16.33–8	S	S	S	S
16.36–131	S	S	S	S
16.39–159	S	S	S	S
16.49–90	S	S	S	S
16.53–72	S	S	S	S
16.58–138	S	S	S	S
16.58–166	S	S	S	S
16.65–32	S	S	S	S
16.69–1	S	S	S	S
16.69–132	S	S	S	S
16.69–142	S	S	S	S
16.70–190	S	S	S	S
16.74–41	S	S	S	S
16.74–68	S	S	S	S
17.17–34	S	S	S	S
17.17–137	S	S	S	S
17.40–176	S	S	S	S
17.48–3	S	S	S	S
17.66–44	S	S	S	S
17.66–45	S	S	S	S
17.77–70	S	S	S	S
K08-17	R	R	R	R
K12-10	R	R	R	R
13.77–5	R	R	R	R
13.78–57	R	R	R	R
14.100–58	R	R	R	R
14.100–59	R	R	R	R
14.101–154	R	R	R	R
14.101–200	R	R	R	R
14.101–225	R	R	R	R
17.68–110	R	R	R	R
17.69–15	R	R	R	R
17.69–23	R	R	R	R

R: resistance, S: susceptibility

Bassil, N.V., T.M. Davis, H. Zhang, S. Ficklin, M. Mittmann, T. Webster, L. Mahoney, D. Wood, E.S. Alperin, U.R. Rosyara, et al. 2015. Development and preliminary evaluation of a 90 K Axiom® SNP array for the allo-octoploid cultivated strawberry Fragaria ×ananassa. BMC Genom. 16:155. doi: 10.1186/s12864-015-1310-1.

 PubMed Web of Science ®Google Scholar