Microsatellite Markers Analysis for the Genetic Characterization and Relationships among Some of Iranian Local Grapevine Accessions (Vitis Vinifera L.)

Figures & data

Table 1. List of grapevine accessions analyzed in the present study

No.	Accession/sample name	No.	Accession/sample name
1	Keraloie	14	Bidaneh Sefid
2	Ghoy Ozoum Habe Gerd	15	Ghoy Ozoum Poost Nazok
3	Ghoy Ozoum Habe Deraz	16	Shahani Gerd
4	Keraloie Sefid	17	Rish Baba
5	Ghoy Ozoum Habe Feshordeh	18	Ghalin Barmaghi Habe Deraz
6	Ghareh Ozoum Kamrang	19	Ghalin Barmaghi Habe Dorosht
7	Makka Ozoumi Habe Deraz	20	Shahani Kamrang
8	Ghareh Ozoum Porrang	21	Ghoghari Dorang
9	Shirshireh	22	Irie Ghileh Porbar
10	Fakhri Qermez	23	Shahani Qazvin
11	Ghoghari Dirras	24	Bidaneh Qermez
12	Asghari	25	Irie Ghileh Habe Dorosht
13	Ghareh Ozoum Dorang (Ablag)

Figure 1. Schematic map of Iran with collection sites for 25 grapevine accessions from Qazvin province. This map was produced using the ggplot2 package in R environment

Table 2. Information on microsatellite loci of the grapevine accessions used in this study including marker name, primer sequences, annealing temperature, and allele size range

Marker no.	Marker name	Primer sequence (5ʹ→3ʹ)	Annealing temperature (°C)	Allele size range (bp)	Reference
1	VVS1	F: CTTCTCAATGATATCTAAAACCATG	51.0	205–227	Thomas and Scott (1993)
		R: ACAATTGGAAACCGCGTGGAG
2	VVS2	F: AAATTCAAAATTCTAATTCAACTGG	52.0	129–155	Thomas and Scott (1993)
		R: CAGCCCGTAAATGTATCCATC
3	VVS3	F: TCGACTTTGATATATTGATGATT	47.0	222–246	Thomas and Scott (1993)
		R: TGCCCTATCAATTAGTTCACCTA
4	VVS4	F: CCATCAGTGATAAAACCTAATGCC	52.5	83–287	Thomas and Scott (1993)
		R: CCCACCTTGCCCTTAGATGTTA
5	VVS5	F: TAGAAAGATGGAAGGAATGGTGAT	51.0	91–190	Thomas and Scott (1993)
		R: ATTGATTTATCAAACACCTTCTACAT
6	VVMD6	F: CTGTGCTAAGACGAAGAAGA	52.0	190–237	Bowers et al. (1999)
		R: ATCTCTAACCCTAAAACCAT
7	VVMD8	F: AGCACATCCACAACATAATG	54.0	140–159	Bowers et al. (1996)
		R: TAACAAACAAGAAGAGGAAT
8	VVMD24	F: GATTTTAGGTTCATGTTGGTGAAGG	56.0	207–236	Bowers et al. (1999)
		R: GTGGATGATGGAGTAGTCACGC
9	VVMD25	F: TTGGATTTGAAATTTATTGAGGGG	56.0	244–276	Bowers et al. (1999)
		R: TTCCGTTAAAGCAAAAGAAAAAGG
10	VrZAG25	F: CTCCACTTCACATCACATGGCATGC	51.5	221–254	Sefc et al., 1999
		R: CGGCCAACATTTACTCATCTCTCCC
11	ISV2	F: CACTGGCCTGTTGGGAGATAAT	55.5	351–432	Thomas and Scott, 1993
		R: CCTTCAACTGGAAAAGCCTGTC
12	ISV3	F: AAGGAGGAGTTGAGATGTAGTA	55.0	132–148	Thomas and Scott, 1993
		R: GAGTAAGAGAGAAGCAAGAAAA
13	ISV4	F: CCATCAGTGATAAAACCTAATGCC	53.0	152–215	Thomas and Scott, 1993
		R: CCCACCTTGCCCTTAGATGTTA
14	Scu15vv	F: TGTTATATGATCCTCCCCCTCCTC	53.5	175–195	Arnold et al., 2002
		R: GCCTATGTGCCAGACCAAAAAC

Figure 2. Polyacrylamide gel profile of amplified product from 25 grapevine accessions using VVS1- and VVDM25-specific primers based on Table 1. L: Molecular ladder SMO313. The length of marker fragments is in base pairs (bp)

Table 3. Summary of marker data revealed by fourteen microsatellite loci in 25 grapevine accessions collected from Iran

Marker no.	Marker name	Na	Freq.	Ho	He	PIC	DP	PID	I
1	VVS1	9	0.22	0.68	0.85	0.85	0.960	0.04	2.00
2	VVS2	7	0.36	0.68	0.75	0.75	0.903	0.10	1.59
3	VVS3	3	0.61	0.66	0.50	0.50	0.658	0.34	0.79
4	VVS4	6	0.42	0.68	0.71	0.79	0.915	0.08	1.85
5	VVS5	5	0.30	0.56	0.75	0.68	0.896	0.10	1.46
6	VVSMD6	3	0.62	0.68	0.53	0.55	0.717	0.28	0.90
7	VVSMD8	7	0.40	0.60	0.75	0.64	0.905	0.09	1.62
8	VVSMD24	7	0.32	0.68	0.80	0.66	0.936	0.08	1.77
9	VVSMD25	9	0.18	0.72	0.87	0.87	0.971	0.03	2.13
10	VrZAG25	4	0.51	0.61	0.58	0.63	0.771	0.19	1.21
11	ISV2	8	0.23	0.69	0.82	0.81	0.942	0.05	1.82
12	ISV3	2	0.69	0.53	0.49	0.50	0.542	0.29	0.87
13	ISV4	7	0.30	0.67	0.79	0.65	0.921	0.07	1.65
14	Scu15vv	4	0.50	0.60	0.56	0.62	0.782	0.15	1.15
Total		81	–	–	–	–	–	–	–
Min		2	0.18	0.53	0.49	0.50	0.542	0.03	0.79
Max		9	0.69	0.72	0.87	0.87	0.971	0.34	2.13
Average per locus		5.79	0.40	0.65	0.70	0.69	0.844	0.135	1.49

Na, number of different alleles; Freq., major allele frequency; Ho, observed heterozygosity; He, average expected heterozygosity; PIC, polymorphic information content; DP, discrimination power; PID, probability of identity; I, Shannon’s information index.

Figure 3. Distribution of allele frequencies for the loci of fourteen microsatellite markers studied to characterize 25 grapevine accessions. In each graph, horizontal axis represents the allele size (bp) for each microsatellite marker and vertical axis represents the observed allele frequency

Figure 4. Cluster diagram for 25 grapevine accessions using microsatellite marker data based on Jaccard’s similarity coefficient and UPGMA algorithm

Figure 5. Grouping of grapevine accessions. (a) The gap statistic plot showed the optimal number of clusters. (b) Two-dimensional diagram plotted from principal coordinates analysis based on Jaccard’s distance matrix for genetic relationships of 25 grapevine accessions using microsatellites polymorphism data. The numbers at the front of any shape indicate the accession number. The color of the shapes indicates the five different groups identified through the UPGMA clustering

Thomas, M.R., and N.S. Scott. 1993. Microsatellite repeats in grapevine reveal DNA polymorphisms when analyzed as sequence tagged sites (STSs). Theor. Appl. Genet. 86:985–990. doi: 10.1007/BF00211051.

 PubMed Web of Science ®Google Scholar

Bowers, J.E., G.S. Dangl, and C.P. Meredith. 1999. Development and characterization of additional microsatellite DNA markers for grape. Am. J. Enol. Vitic. 50:243–246.

 Web of Science ®Google Scholar

Bowers, J.E., G.S. Dangl, R. Vignani, and C.P. Meredith. 1996. Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628–633. doi: 10.1139/g96-080.

 PubMed Web of Science ®Google Scholar

Sefc, K.M., F. Regner, E. Turetschek, J. Glossl, and H. Steinkellner. 1999. Identification of microsatellite sequences in Vitis riparia and their applicability for genotyping of different Vitis species. Genome 42:367–373. doi: 10.1139/g98-168.

 PubMed Web of Science ®Google Scholar

Arnold, C., M. Rossetto, J. Mcnally, and R.J. Henry. 2002. The application of SSRs characterized for grape (Vitis vinifera) to conservation studies in Vitaceae. Am. J. Bot. 89(1):22–28. doi: 10.3732/ajb.89.1.22.

 PubMed Web of Science ®Google Scholar