Maternal prenatal depressive symptoms predict infant NR3C1 1F and BDNF IV DNA methylation

Figures & data

Table 1. Maternal demographic and salivary cortisol variables

Demographic Variables	Control Group (N = 37)	Depressive symptom group (N = 20)
Age (mean, SD)	32.14 (4.33)	31.85 (4.50)
Education (n, %)
A-level	1 (2.7)	0
Undergraduate degree	16 (43.2)	9 (45)
NVQ	2 (5.4)	1 (5)
Postgraduate degree	18 (48.6)	10 (50)
Ethnicity (n, %)
Caucasian	35 (84.6)	16 (80)
Black	0	1 (5)
Asian	1 (2.7)	3 (15)
Mixed Race	1 (2.7)	0
Alcohol units/week (n, %)
None	28 (75.7)	17 (85)
1–5	9 (24.3)	3 (15)
Cigarettes/week (n, %)
None	33 (89.2)	18 (90)
Did not respond	4 (10.8)	2 (10)
Weeks of gestation (mean, SD)	28.4 (12.4)	29.9 (6.67)
Planned Pregnancy (n, %)	33 (89.2)	18 (90)
Previous history of mental health problems (n, %)	10 (27)	7 (35)
Prenatal EPDS (depression)	4.68 (2.82)	12.2 (2.12)
Postnatal EPDS (depression)	6.22 (3.30)	8.95 (4.96)
Salivary Cortisol Variables (nmol/l)
Mean change in response to stressor (mean, range)	−0.54 (−8.63 − 5.66)	−1.13 (−4.13 − 3.07)
Log AUC diurnal cortisol (mean, range)	15.81 (6.70 − 25.66)	17.79 (6.61 − 31.32)
EPDS: Edinburgh Postnatal Depression Scale, NVQ: National Vocational Qualification

Figure 1. Percent methylation at each CpG site (1–10) within the examined NR3C1 1F region for the depression-exposed and control infants. (A) shows the values for the male infants and (B) the female infants.

Table 2. Regression model using prenatal depression and infant gender to predict infant NR3C1 IF and BDNF IV methylation

		Unstandardized coefficients
Model		B	Std. error	Standardized coefficients Beta	t	Sig.
Outcome: Mean NR3C1 1F methylation
1	Batch number	0.238	0.234	0.167	1.208	0.233
	Postnatal depression	0.338	0.40	0.117	0.845	0.402
2	Batch number	0.263	0.241	0.155	1.089	0.282
	Postnatal depression	0.352	0.432	0.122	0.815	0.419
	Prenatal depression	0.066	0.184	0.053	0.36	0.720
	Infant gender	0.069	0.185	0.054	0.372	0.711
3	Batch number	0.157	0.233	0.093	0.676	0.502
	Postnatal depression	0.427	0.412	0.148	1.037	0.305
	Prenatal depression	−0.024	0.179	−0.019	−0.132	0.896
	Infant gender	0.114	0.177	0.089	0.642	0.524
	Prenatal depression*gender	−0.435	0.176	−0.350	−2.475	0.017
Outcome: Mean BDNF IV methylation
1	Batch number	0.114	0.217	0.072	0.524	0.602
	Postnatal depression	−0.405	0.382	−0.145	−1.061	0.294
2	Batch number	0.253	0.205	0.16	1.232	0.224
	Postnatal depression	−0.402	0.376	−0.144	−1.069	0.290
	Prenatal depression	−0.419	0.164	−0.336	−2.565	0.013
	Infant gender	−0.322	0.158	−0.271	−2.034	0.047
3	Batch number	0.274	0.209	0.173	1.31	0.196
	Postnatal depression	−0.421	0.38	−0.151	−1.107	0.274
	Prenatal depression	−0.427	0.165	−0.343	−2.59	0.013
	Infant gender	−0.296	0.165	−0.249	−1.796	0.079
	Prenatal depression*gender	0.100	0.162	0.084	0.620	0.538

Figure 2. Percent methylation at each CpG site within the examined BDNF IV region for the depression-exposed and control infants.

Figure 3. Schematic and the analyzed sequence of the NR3C1 (A) and BDNF (B) gene. Shown are specific CpG sites analyzed using bisulfite-pyrosequencing assays as well as NGFI-A (blue box) and CREB (purple box) binding sites within NR3C1 exon 1F and BDNF promoter IV, respectively.

Table 3. PCR and pyrosequencing primers

NR3C1 1F Assay 2 – CpG sites 5–1 - chr5:143,404,013–143,404,147*
PCR primer forward- Biotinylated	/5Biosg/ GTTGTTATTAGTAGGGGTATTGG
PCR primer reverse	AACCACCCAATTTCTCCAATTTCTTTTC
Pyrosequencing primer (reverse)	CAACTCCCCCACTCCAAACCC
NR3C1 1F Assay 1 – CpG sites 6–10 - chr5:143,404,011–143,404,097*
PCR primer forward	AGTTTTAGAGTGGGTTTGGAG
PCR primer reverse-Biotinylated	/5Biosg/ AAAACCACCCAATTTCTCCAATTTCTT
Pyrosequencing primer (forward)	GAGTGGGTTTGGAGT
BDNF IV – CpG sites 1–5 - chr11:27,701,519–27,701,826*
PCR primer forward	GGGTTGGAAGTGAAAATATTTGTAAA
PCR primer reverse-Biotinylated	/5Biosg/CCCCATCAACCAAAAACTCCATTTAATCTC
Pyrosequencing primer (forward)	GGTAGAGGAGGTATTATATGATAG

* Genomic coordinates show genomic regions amplified by PCR and are based on the UCSC Genome Browser Human Dec. 2013 (GRCh38/hg38) Assembly.