The role of DNA methylation in human trophoblast differentiation

Figures & data

Figure 1. (a) Schematic diagram of a first trimester human placental villus showing the three major mature trophoblast populations. Extravillous trophoblasts are shown invading into the decidua and remodelling a maternal spiral artery (b) Flow diagram showing the lineage differentiation pathway of trophectoderm derived trophoblast populations.

Table 1. Table of sequenom massARRAY primers.

Primer Name	Primer Sequence
LOC100289580 Forward	aggaagagagGTATATTTGTGAGTAGATTTGGGGG
LOC100289580 Reverse	cagtaatacgactcactatagggagaaggctAAATAATTCCCATAAACCCTAAAAA
GALNT6 Forward	aggaagagagGTTTGGTGGAGAGGAAGTTTGTAT
GALNT6 Reverse	cagtaatacgactcactatagggagaaggctCCTCTACCCTTTAACCCTCAAAAAT
CPZ Forward	aggaagagagGGTTGGTTGTATTGTTTTTTATATGTTT
CPZ Reverse	cagtaatacgactcactatagggagaaggctAAAAAAAACCTCACCTAATAACCCA
C22orf31 Forward	aggaagagagTTTGAGGTAGAGTTATTGGGTTTTTT
C22orf31 Reverse	cagtaatacgactcactatagggagaaggctCCAATACCACTATTCCTCCAATAAC
GATA2 Forward	aggaagagagTTTTTATTTTTTTTGGTGAGGATTG
GATA2 Reverse	cagtaatacgactcactatagggagaaggctAACTCCTACCCAACAACCCC
CARD9 Forward	aggaagagagAGTTGTATAAGAAGGTTATAGGTAAGGA
CARD9 Reverse	cagtaatacgactcactatagggagaaggctACAACTAAATCAAACCTAACTCCCC

Table 2. Table of microRNA primers.

miRNA	Primer Sequence
Universal Primer	GCATAGACCTGAATGGCGGTA
hsa-let-7b-5p	CGTTCTGAGGTAGTAGGTTGTGTG
hsa-miR-637	CTTTCGGGCTCTGCGTAAA
hsa-miR-193b-3p	GCCCTCAAAGTCCCGCTAA
hsa-miR-525-3p	GAAGGCGCTTCCCTTTAGA
hsa-miR-103a-3p	CAGCATTGTACAGGGCTATGAA
hsa-miR-21-5p	GCTAGCTTATCAGACTGATGTTGAAA

Table 3. Summary table of differential methylation between trophoblast populations.

	SP v CTB	SP v EVT	CTB v EVT
Total differentially methlated CpG sites	158	2991	7061
Hypermethylated CpG sites	11.4% (18)	95% (2842)	96.6% (6819)
Hypomethylated CpG sites	88.6% (140)	5% (149)	3.4% (242)
Total genes impacted	32	1487	3185
Hypermethylated genes	10	1420	3059
Hypomethylated genes	18	45	74
Genes containing both hypo and hypermethylated CpG sites	4	22	52

Table 4. Table of differentially methylated genes regulating a stem cell phenotype and/or cell cycle regulation and proliferation in side-population compared to cytotrophoblasts or extravillous trophoblasts.

Gene	Location	Methylation difference in side-population trophoblasts compared to cytotrophoblasts	q. value	Methylation difference in side-population trophoblasts compared to extravillous trophoblasts	q. value	Function/ Biological Relevance
PRDM2	Chr1: 14109294	3.8	0.9690	−32.6	0.0004	Maintains muscle stem cells in a quiescent state. Aids stem cell self-renewal [56].
	Chr1: 14109300	4.2	0.9690	−28.9	0.0041
LRP5	Chr11: 68139919	0.5	0.9690	5.0	0.0006	Canonical Wnt signalling through LRP5 permits the regenerative capacity of mammary epithelial stem cells [57].
	Chr11: 68141102	0.1	0.9690	32.3	0.0094
	Chr11: 68141123	4.0	0.9690	36.7	0.0005
	Chr11: 68097308	6.2	0.9363	−33.4	0.0026
	Chr11: 68097314	3.9	0.9690	−31.6	0.0029
	Chr11: 68153864	20.8	0.7617	−37.6	0.0002
TPT1	Chr13: 45914874	34.1	<0.0001	35.4	<0.0001	Enhances Oct4 and Nanog expression in embryonic stem cells [42].
	Chr13: 45914880	34.7	<0.0001	35.5	<0.0001
RCC1	Chr1: 28845226	14.1	0.0039	14.1	0.0002	Critical cell cycle regulator involved in the S-phase of mitosis [58].
	Chr1: 28845238	14.1	0.0042	13.2	0.0028
PMF1	Chr1: 156186626	10.6	0.0003	8.3	0.0021	Regulates transcription of genes involved in cell growth and cell death [59].
	Chr1: 156186325	−5.0	<0.0001	8.3	0.0021
	Chr1: 156186433	−2.8	0.0004	−1.2	0.3362
	Chr1: 156186383	−0.1	0.9690	1.6	0.0070
	Chr1: 156186392	−0.7	0.9193	2.3	<0.0001
	Chr1: 156186393	−0.2	0.9690	1.6	0.0008
	Chr1: 156186496	−1.1	0.9193	3.1	0.00123
B4GALT6	Chr18: 29265352	11.3	0.0088	10.3	0.0220	Required for normal proliferation and differentiation of epithelial cells. Murine knockout models show growth retardation and premature fetal death [60].
MAPK11	Chr22: 50717438	−34.5	0.0086	9.7	0.7256	Required for cytotrophoblast differentiation to syncytiotrophoblast. Inhibition enhances cytotrophoblast proliferation [61].
DHX34	Chr19: 47852601	17.6	<0.0001	17.6	<0.0001	Involved in nonsense-mediated mRNA decay, a process important for stem cell differentiation [62].
	Chr19: 47852604	17.2	<0.0001	17.2	<0.0001
	Chr19: 47852629	18.2	<0.0001	18.2	<0.0001
MDM4	Chr1: 204537885	17.0	0.9193	−41.1	0.0010	Promotes cell proliferation though inhibition of the p53 pathway [63].
	Chr1: 204537886	0.7	0.9680	−57.2	<0.0001
	Chr1: 204537940	−1.9	0.9690	−30.5	0.0022
HOXB1	Chr17: 46570458	−0.6	0.9690	−28.6	0.0031	Mediates neural stem and progenitor proliferation and differentiation [64].
DCAF12L1	ChrX:125715240	−3.6	<0.0001	−1.2	0.3769	Expressed in murine TSC and is dcaf12L is down-regulated upon Elf5 depletion [34].
	ChrX:125715250	−3.7	<0.0001	−1.5	0.1722
	ChrX:125715261	−3.0	0.0002	−2.6	0.0003
	ChrX:125715276	−3.0	0.0002	−2.5	0.0007
	ChrX:125715286	−3.0	0.0004	−2.1	0.0011
	ChrX: 125715243	−2.1	0.0272	−2.7	<0.0001
	ChrX: 125715281	−1.0	0.9193	−2.1	0.0011
STAB1	Chr3: 52520822	4.9	0.9690	−35.1	0.0006	Required for rat TSC self-renewal and maintenance [35].

Table 5. Table of miRNA involved in signalling pathways regulating stem cells.

miRNA differentially methylated between side-population trophoblasts and extravillous trophoblasts	miRNA differentially methylated between cytotrophoblasts and extravillous trophoblasts
hsa-miR-3194-5p	hsa-miR-3194-5p
hsa-miR-193b-3p	hsa-miR-193b-3p
hsa-miR-657	hsa-miR-657
hsa-miR-2278	hsa-miR-2278
hsa-miR-339-5p	hsa-miR-339-5p
hsa-miR-3177-5p	hsa-miR-3177-5p
hsa-miR-2110	hsa-miR-2110
hsa-miR-339-3p	hsa-miR-339-3p
hsa-miR-193b-5p	hsa-miR-193b-5p
hsa-miR-548au-5p	hsa-miR-548au-5p
hsa-miR-3174	hsa-miR-3174
hsa-miR-548au-3p	hsa-miR-548au-3p
hsa-miR-637	hsa-miR-637
hsa-miR-200a-3p	hsa-miR-130a-3p
hsa-miR-23a-3p	hsa-miR-150-5p
hsa-miR-200a-5p	hsa-miR-3619-5p
hsa-miR-23a-5p	hsa-miR-140-3p
hsa-let-7b-3p	hsa-miR-2467-5p
	hsa-miR-326
	hsa-miR-330-3p
	hsa-miR-330-5p
	hsa-miR-33a-3p
	hsa-miR-365a-3p
	hsa-miR-708-5p
	hsa-miR-5582-3p
	hsa-miR-140-5p
	hsa-miR-33a-5p
	hsa-miR-135b-5p
	hsa-miR-4783-3p
	hsa-miR-150-3p
	hsa-miR-135b-3p
	hsa-miR-548z
	hsa-miR-199a-3p
	hsa-miR-3943
	hsa-miR-4487
	hsa-miR-378i
	hsa-let-7a-2-3p
	hsa-miR-4525
	hsa-miR-199a-5p
	hsa-miR-708-3p
	hsa-miR-587
	hsa-miR-4786-3p
	hsa-miR-138–2-3p
	hsa-miR-944
	hsa-miR-5008-5p
	hsa-miR-130a-5p
	hsa-miR-5008-3p
	hsa-miR-3619-3p

Figure 2. (a) Cluster dendogram showing hierarchical clustering based on global methylation for side-population trophoblasts (SP), cytotrophoblasts (CTB) and extravillous trophoblasts (EVT) from the four placentae used in this work (denoted by numbers 1–4). (b) Venn diagram of differentially methylated CpG sites between SP and CTB, SP and EVT or CTB and EVT.

Figure 3. (a) Pie chart showing the mean distribution of CpGs in promoter, exon, intron and intergenic regions across all 12 trophoblast samples. b-d) Pie charts showing the percentage of differentially methylated CpG located in promoter, exon, intron and intergenic regions when (b) side-population trophoblasts (SP) are compared to cytotrophoblasts (CTB), (c) SP are compared to extravillous trophoblasts (EVT), or (d) CTB are compared to EVT.

Figure 4. (a) Bar graph of the percentage methylation at 16 CpG across 6 genes that were significantly differentially methylation when analysed using RRBS and chosen for further validation using Sequenom methylation analysis in side-population trophoblasts, cytotrophoblasts and extravillous trophoblasts. Each number correlates to the CpG in the Sequenom amplicon presented in Figure 4 plots B-G. (b-g) Dot plots showing percentage methylation of CpGs in GATA2 (b), CPZ (c), CARD9 (d), GALNT6 (e), LOC100289580 (f), and C22orf31 (g) in SP, CTB, and EVT when analysed by Sequenom MassARRAY EpiTYPER Analysis. * indicates an adjusted p value ≤0.05 and ** indicates an adjusted p value ≤0.01, *** indicates an adjusted p value ≤0.001, **** indicates an adjusted p value ≤0.0001. Error bars SEM.

Table 6. Table of differentially methylated genes related to EMT, and/or metastatic cancers were up-regulated in extravillous trophoblasts compared to cytotrophoblasts.

Gene	Methylation status at CpGi in promoter region in EVT compared to CTB	Averaged fold change in mRNA expression in EVT compared to CTB	Function/Biological Relevance	Reference
ABR	hypomethylated	2.8*	BCR related protein with functional activity that may regulate Rho family members involved in cytoskeletal reorganisation.	[65]
ADAM19	hypomethylated	9.1^‡	Involved in the EMT in glioblastoma.	[66]
AGRN	hypomethylated	4.9^‡	AGRN knockdowns reduce oral squamous cell carcinoma migration	[67]
AQPEP	hypomethylated	7.9^‡	An EVT specific protein involved in invasion and migration.	[68]
B3GNT7	hypomethylated	6.8^†	Is upregulated in metastatic breast cancer and enhances cell migration and invasion in vitro.	[69]
CAPN2	hypomethylated	2.7*	Promotes EMT, migration and invasion in metastatic cancer.	[70]
CARD9	hypomethylated	4.7*	CARD9 plays a role in manipulating the tumour microenvironment to enhance colon cancer metastasis.	[71]
CDR2	hypomethylated	3.1^†	Upregulated expression of CDR2 is associated with poor prognosis in renal cell carcinoma and may contribute to cancer metastasis.	[72]
DLX4	hypomethylated	2.5*	Involved in EMT, invasion and migration during embryogenesis and placentation.	[73]
FAM163A	hypomethylated	4.6^†	Associated with high-risk neuroblastoma and metastasis to bone marrow.	[74]
FERMT3	hypomethylated	3.1*	Encourages EMT,invasion, metastasis and angiogenesis in breast cancer.	[75]
FLT4	hypermetylated	5.8‡	Associated with metastatic epithelial malignancies and EMT.	[76]
HCK	hypomethylated	3.2*	Contributes to cell migration and actin remodelling.	[77]
HMHA1	hypermethylated	3.5‡	Regulates reorganisation of the cytoskeleton and enhancing cell motility	[78]
IL17RA	hypomethylated	2.9^†	Involved in gastric cancer migration and osetosarcoma metastasis.	[79]
IRF7	hypomethylated	2.4^†	Enables glioma cell invasion.	[80]
KCNF1	hypomethylated	2.0^†	Ion channel upregulated in invasive cancer.	[81]
KIF3C	hypomethylated	2.7^†	Associated with the EMT and breast cancer progression and metastasis.	[82]
KLF13	hypomethylated	2.1^†	Oral cancer cells overexpress KLF13 and contributes to malignancy in other tissues.	[83]
KLF6	hypomethylated	2.5^†	KLF6 is involved in the EMT and present in HER2-ERBB2 positive ductal breast cancer cells.	[84]
LHX2	hypomethylated	4.4^†	Involved in EMT during normal and cancerous breast epithelium development.	[85]
LIMS2	hypomethylated	3.4*	Involved in interactions which help cell morphology and migration.	[86]
LOXL1	hypomethylated	7.9^‡	Known to drive EMT in cancers.	[87]
LPCAT1	hypomethylated	4.3^†	Associated with increased breast cancer grade and metastasis.	[88]
LRFN4	hypomethylated	2.1^†	Expressed in both solid tumours and blood cancers. Involved in cytoskeletal reorganisation which allows cell motility.	[89]
MICALL2	hypomethylated	11.6^‡	Likely an important regulator of EMT in ovarian cancer. Silencing MICALL2 in ovarian cancers inhibits proliferative, invasive and migratory capacity of tumours.	[90]
MT1E	hypomethylated	4.9^‡	Involved in migration and invasion of bladder cancer and glioma.	[91]
NCOR2	hypomethylated	2.9^‡	Associated with distant metastasis of breast cancer cells	[92]
NFATC1	hypomethylated	2.8^†	Associated with EMT.	[93]
NRN1	hypomethylated	5.3^‡	Plays a role in the migration of bone marrow derived mesenchymal stem cells.	[94]
NUMB	hypermethylated	3.2†	NUMB isoforms are involved enhancing the EMT and invasion and migration of breast cancer cells.	[95]
PIK3CD	hypomethylated	3.5*	Downregulation of PIK3CD inhibits invasion and migration of colorectal cancer cells	[96]
PIM3	hypomethylated	2.0^†	Overexpression of PIM3 enhances the invasive and migratory capacity of ovarian and prostate cancer cells. Regulates genes that enhance the EMT.	[97]
PRDM16	hypomethylated	3.3*	Interacts with SKI to enhance gastric cancer growth.	[98]
RUSC2	hypomethylated	3.7^†	Important migration of non-small cell lung cancer.	[99]
SKI	hypomethylated	2.1^†	Overexpression in melanoma cells enhances migration in vitro.	[100]
SLC16A3	hypomethylated	13.7^‡	Associated with hepatocellular carcinoma invasion and migration. Contributes to EMT in breast cancer.	[101]
SOD2	hypomethylated	3.7*	Mitochondrial enzyme which promotes EMT.	[102]
TGFB1	hypomethylated	6.6^‡	In later stages of tumorigenesis in vivo TGFB1 promotes the EMT and cancer invasion and metastasis.	[103]
TPM2	hypomethylated	5.6^‡	Associated with EMT in lens epithelium	[104]
WNT1	hypomethylated	3.0*	Associated with highly metastatic advanced cancers. Cancer cell migration and invasion can be inhibited though blockade of the Wnt-1 pathway and inhibition of EMT.	[105]
ZYX	hypomethylated	2.8^†	Regulates lung cancer cell motility. Involved in reorganisation of cytoskeletal proteins in EMT.	[106]

Statistically significant values are labelled either *adjusted p value<0.05, † adjusted p value <0.01 or ‡ adjusted p value <0.001. EVT, extravillous trophoblasts; CTB, cytotrophoblast.

Figure 5. Bar graphs showing the normalised miRNA expression in side-population trophoblasts (SP), cytotrophoblasts (CTB) or extravillous trophoblasts (EVT) for (a) miR-let-7b, (b) miR-637 and (c) miR4487. ** indicates an adjusted p value ≤0.01. Error bars are SEM.

Figure 6. Bar graphs showing (a) the normalised mRNA fold change in extravillous trophoblasts (EVT) compared to cytotrophoblasts (CTB) of the top 20 significantly different genes associated with EMT or invasive cancer that were hypomethylated at CpG islands in promoters regions of EVT compared to CTB (b) the normalised mRNA fold change in CTB compared to EVT of the top 20 significantly different genes that were hypermethylated at CpG island in promoters regions of CTB compared to EVT.

Cheedipudi S, Puri D, Saleh A, et al. A fine balance: epigenetic control of cellular quiescence by the tumor suppressor PRDM2/RIZ at a bivalent domain in the cyclin a gene. Nucleic Acids Res. 2015;43:6236–6256.

 PubMed Web of Science ®Google Scholar

Lindvall C, Evans NC, Zylstra CR, et al. The Wnt signaling receptor Lrp5 is required for mammary ductal stem cell activity and Wnt1-induced tumorigenesis. J Biol Chem. 2006;281:35081–35087.

 PubMed Web of Science ®Google Scholar

Koziol MJ, Garrett N, Gurdon JB. Tpt1 activates transcription of oct4 and nanog in transplanted somatic nuclei. Curr Biol. 2007;17:801–807.

 PubMed Web of Science ®Google Scholar

Ohtsubo M, Kai R, Furuno N, et al. Isolation and characterization of the active cDNA of the human cell cycle gene (RCC1) involved in the regulation of onset of chromosome condensation. Genes Dev. 1987;1:585–593.

 PubMed Web of Science ®Google Scholar

Celano P, Berchtold CM, Giardiello FM, et al. Modulation of growth gene expression by selective alteration of polyamines in human colon carcinoma cells. Biochem Biophys Res Commun. 1989;165:384–390.

 PubMed Web of Science ®Google Scholar

Asano M, Furukawa K, Kido M, et al. Growth retardation and early death of beta-1,4-galactosyltransferase knockout mice with augmented proliferation and abnormal differentiation of epithelial cells. Embo J. 1997;16:1850–1857.

 PubMed Web of Science ®Google Scholar

Johnstone ED, Sibley CP, Lowen B, et al. Epidermal growth factor stimulation of trophoblast differentiation requires MAPK11/14 (p38 MAP kinase) activation. Biol Reprod. 2005;73:1282–1288.

 PubMed Web of Science ®Google Scholar

Melero R, Hug N, Lopez-Perrote A, et al. The RNA helicase DHX34 functions as a scaffold for SMG1-mediated UPF1 phosphorylation. Nat Commun. 2016;7:10585.

 PubMed Web of Science ®Google Scholar

Francoz S, Froment P, Bogaerts S, et al. Mdm4 and Mdm2 cooperate to inhibit p53 activity in proliferating and quiescent cells in vivo. Proc Natl Acad Sci U S A. 2006;103:3232–3237.

 PubMed Web of Science ®Google Scholar

Gouti M, Gavalas A. Hoxb1 controls cell fate specification and proliferative capacity of neural stem and progenitor cells. Stem Cells. 2008;26:1985–1997.

 PubMed Web of Science ®Google Scholar

Pearton DJ, Smith CS, Redgate E, et al. Elf5 counteracts precocious trophoblast differentiation by maintaining Sox2 and 3 and inhibiting Hand1 expression. Dev Biol. 2014;392:344–357.

 PubMed Web of Science ®Google Scholar

Asanoma K, Kubota K, Chakraborty D, et al. SATB homeobox proteins regulate trophoblast stem cell renewal and differentiation. J Biol Chem. 2012;287:2257–2268.

 PubMed Web of Science ®Google Scholar

Chuang TH, Xu X, Kaartinen V, et al. Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein family. Proc Natl Acad Sci U S A. 1995;92:10282–10286.

 PubMed Web of Science ®Google Scholar

Wang X, Wang E, Cao J, et al. MiR-145 inhibits the epithelial-to-mesenchymal transition via targeting ADAM19 in human glioblastoma. Oncotarget. 2017;8:92545–92554.

 PubMedGoogle Scholar

Kawahara R, Granato DC, Carnielli CM, et al. Agrin and perlecan mediate tumorigenic processes in oral squamous cell carcinoma. PloS one. 2014;9:e115004.

 PubMed Web of Science ®Google Scholar

Horie A, Fujiwara H, Sato Y, et al. Laeverin/aminopeptidase Q induces trophoblast invasion during human early placentation. Hum Reprod. 2012;27:1267–1276.

 PubMed Web of Science ®Google Scholar

Canevari RA, Marchi FA, Domingues MA, et al. Identification of novel biomarkers associated with poor patient outcomes in invasive breast carcinoma. Tumour Biol. 2016;37:13855–13870.

 PubMedGoogle Scholar

Miao C, Liang C, Tian Y, et al. Overexpression of CAPN2 promotes cell metastasis and proliferation via AKT/mTOR signaling in renal cell carcinoma. Oncotarget. 2017;8:97811–97821.

 PubMedGoogle Scholar

Yang M, Shao JH, Miao YJ, et al. Tumor cell-activated CARD9 signaling contributes to metastasis-associated macrophage polarization. Cell Death Differ. 2014;21:1290–1302.

 PubMed Web of Science ®Google Scholar

Kaufmann MR, Schraml P, Hermanns T, et al. Onconeuronal antigen Cdr2 correlates with HIF prolyl-4-hydroxylase PHD1 and worse prognosis in renal cell carcinoma. Exp Mol Pathol. 2013;94:453–457.

 PubMed Web of Science ®Google Scholar

Sun YY, Lu M, Xi XW, et al. Regulation of epithelial-mesenchymal transition by homeobox gene DLX4 in JEG-3 trophoblast cells: a role in preeclampsia. Reprod Sci. 2011;18:1138–1145.

 PubMed Web of Science ®Google Scholar

Vasudevan SA, Russell HV, Okcu MF, et al. Neuroblastoma-derived secretory protein messenger RNA levels correlate with high-risk neuroblastoma. J Pediatr Surg. 2007;42:148–152.

 PubMed Web of Science ®Google Scholar

Sossey-Alaoui K, Pluskota E, Davuluri G, et al. Kindlin-3 enhances breast cancer progression and metastasis by activating Twist-mediated angiogenesis. FASEB J. 2014;28:2260–2271.

 PubMed Web of Science ®Google Scholar

Li C, Zhu M, Lou X, et al. Transcriptional factor OCT4 promotes esophageal cancer metastasis by inducing epithelial-mesenchymal transition through VEGF-C/VEGFR-3 signaling pathway. Oncotarget. 2017;8:71933–71945.

 PubMedGoogle Scholar

Guiet R, Poincloux R, Castandet J, et al. Hematopoietic cell kinase (Hck) isoforms and phagocyte duties - from signaling and actin reorganization to migration and phagocytosis. Eur J Cell Biol. 2008;87:527–542.

 PubMed Web of Science ®Google Scholar

de Kreuk BJ, Schaefer A, Anthony EC, et al. The human minor histocompatibility antigen 1 is a RhoGAP. PloS one. 2013;8:e73962.

 PubMed Web of Science ®Google Scholar

Jiang Y-X, Li P-A, Yang S-W, et al. Increased chemokine receptor IL-17RA expression is associated with poor survival in gastric cancer patients. Int J Clin Exp Pathol. 2015;8:7002–7008.

 PubMedGoogle Scholar

Kim JK, Jin X, Ham SW, et al. IRF7 promotes glioma cell invasion by inhibiting AGO2 expression. Tumour Biol. 2015;36:5561–5569.

 PubMedGoogle Scholar

Hwang ES, Nyante SJ, Yi Chen Y, et al. Clonality of lobular carcinoma in situ and synchronous invasive lobular carcinoma. Cancer. 2004;100:2562–2572.

 PubMed Web of Science ®Google Scholar

Wang C, Wang C, Wei Z, et al. Suppression of motor protein KIF3C expression inhibits tumor growth and metastasis in breast cancer by inhibiting TGF-beta signaling. Cancer Lett. 2015;368:105–114.

 PubMed Web of Science ®Google Scholar

Henson BJ, Gollin SM. Overexpression of KLF13 and FGFR3 in oral cancer cells. Cytogenet Genome Res. 2010;128:192–198.

 PubMedGoogle Scholar

Gehrau RC, D’Astolfo DS, Dumur CI, et al. Nuclear expression of KLF6 tumor suppressor factor is highly associated with overexpression of ERBB2 oncoprotein in ductal breast carcinomas. PloS one. 2010;5:e8929.

 PubMed Web of Science ®Google Scholar

Kuzmanov A, Hopfer U, Marti P, et al. LIM-homeobox gene 2 promotes tumor growth and metastasis by inducing autocrine and paracrine PDGF-B signaling. Mol Oncol. 2014;8:401–416.

 PubMed Web of Science ®Google Scholar

Zhang Y, Chen K, Guo L, et al. Characterization of PINCH-2, a new focal adhesion protein that regulates the PINCH-1-ILK interaction, cell spreading, and migration. J Biol Chem. 2002;277:38328–38338.

 PubMed Web of Science ®Google Scholar

Cuevas EP, Eraso P, Mazon MJ, et al. LOXL2 drives epithelial-mesenchymal transition via activation of IRE1-XBP1 signalling pathway. Sci Rep. 2017;7:44988.

 PubMedGoogle Scholar

Abdelzaher E, Mostafa MF. Lysophosphatidylcholine acyltransferase 1 (LPCAT1) upregulation in breast carcinoma contributes to tumor progression and predicts early tumor recurrence. Tumour Biol. 2015;36:5473–5483.

 PubMedGoogle Scholar

Konakahara S, Saitou M, Hori S, et al. A neuronal transmembrane protein LRFN4 induces monocyte/macrophage migration via actin cytoskeleton reorganization. FEBS Lett. 2011;585:2377–2384.

 PubMed Web of Science ®Google Scholar

Zhu LY, Zhang WM, Yang XM, et al. Silencing of MICAL-L2 suppresses malignancy of ovarian cancer by inducing mesenchymal-epithelial transition. Cancer Lett. 2015;363:71–82.

 PubMed Web of Science ®Google Scholar

Wu Y, Siadaty MS, Berens ME, et al. Overlapping gene expression profiles of cell migration and tumor invasion in human bladder cancer identify metallothionein 1E and nicotinamide N-methyltransferase as novel regulators of cell migration. Oncogene. 2008;27:6679–6689.

 PubMed Web of Science ®Google Scholar

Green AR, Burney C, Granger CJ, et al. The prognostic significance of steroid receptor co-regulators in breast cancer: co-repressor NCOR2/SMRT is an independent indicator of poor outcome. Breast Cancer Res Treat. 2008;110:427–437.

 PubMed Web of Science ®Google Scholar

La Belle AA, Schiemann WP. The propensity for epithelial-mesenchymal transitions is dictated by chromatin states in the cancer cell of origin. Stem Cell Investig. 2017;4:44.

 PubMedGoogle Scholar

Zito A, Cartelli D, Cappelletti G, et al. Neuritin 1 promotes neuronal migration. Brain Struct Funct. 2014;219:105–118.

 PubMed Web of Science ®Google Scholar

Karaczyn AA, Adams TL, Cheng RY, et al. Human NUMB6 induces epithelial-mesenchymal transition and enhances breast cancer cells migration and invasion. J Cell Biochem. 2017;118:237–251.

 PubMed Web of Science ®Google Scholar

Zhong M, Bian Z, Wu Z. miR-30a suppresses cell migration and invasion through downregulation of PIK3CD in colorectal carcinoma. Cell Physiol Biochem. 2013;31:209–218.

 PubMed Web of Science ®Google Scholar

Liu J, Qu X, Shao L, et al. Pim-3 enhances melanoma cell migration and invasion by promoting STAT3 phosphorylation. Cancer Biol Ther. 2018;19:160–168.

 PubMed Web of Science ®Google Scholar

Takahata M, Inoue Y, Tsuda H, et al. SKI and MEL1 cooperate to inhibit transforming growth factor-beta signal in gastric cancer cells. J Biol Chem. 2009;284:3334–3344.

 PubMed Web of Science ®Google Scholar

Duan B, Cui J, Sun S, et al. EGF-stimulated activation of Rab35 regulates RUSC2-GIT2 complex formation to stabilize GIT2 during directional lung cancer cell migration. Cancer Lett. 2016;379:70–83.

 PubMed Web of Science ®Google Scholar

Chen D, Lin Q, Box N, et al. SKI knockdown inhibits human melanoma tumor growth in vivo. Pigment Cell Melanoma Res. 2009;22:761–772.

 PubMed Web of Science ®Google Scholar

Kondaveeti Y, Guttilla Reed IK, White BA. Epithelial-mesenchymal transition induces similar metabolic alterations in two independent breast cancer cell lines. Cancer Lett. 2015;364:44–58.

 PubMed Web of Science ®Google Scholar

Li W, Cao L, Han L, et al. Superoxide dismutase promotes the epithelial-mesenchymal transition of pancreatic cancer cells via activation of the H2O2/ERK/NF-kappaB axis. Int J Oncol. 2015;46:2613–2620.

 PubMed Web of Science ®Google Scholar

Brown KA, Aakre ME, Gorska AE, et al. Induction by transforming growth factor-β1 of epithelial to mesenchymal transition is a rare event in vitro. Breast Cancer Res. 2004;6:R215–R31.

 PubMed Web of Science ®Google Scholar

Kubo E, Hasanova N, Fatma N, et al. Elevated tropomyosin expression is associated with epithelial-mesenchymal transition of lens epithelial cells. J Cell Mol Med. 2013;17:212–221.

 PubMed Web of Science ®Google Scholar

Wang JM, Huang FC, Kuo MH, et al. Inhibition of cancer cell migration and invasion through suppressing the Wnt1-mediating signal pathway by G-quadruplex structure stabilizers. J Biol Chem. 2014;289:14612–14623.

 PubMed Web of Science ®Google Scholar

Mori M, Nakagami H, Koibuchi N, et al. Zyxin mediates actin fiber reorganization in epithelial-mesenchymal transition and contributes to endocardial morphogenesis. Mol Biol Cell. 2009;20:3115–3124.

 PubMed Web of Science ®Google Scholar