Mesophyll-specific phytochromes impact chlorophyll light-harvesting complexes (LHCs) and non-photochemical quenching

Figures & data

Table 1. BVR activities in BVR lines.

Plant line^a	BVR activity (µmol h^−1mg^−1)^b	Relative BVR activity^c
No-0WT	ND^d	ND
35S::pBVR3	16.3	1.0
CAB3::pBVR1	34.9	2.1
CAB3::pBVR2	46.2	2.8
CAB3::pBVR3	11.1	0.7

^aPlants were grown under white light (100 µmol m⁻² s⁻¹) with a long-day photoperiod (16-h-light and 8-h-dark cycle) for 30 d. Rosette leaves were harvested and frozen with liquid nitrogen, and soluble protein extracts were used for BVR assay.

^bValues were means from four replicates.

^cRelative to BVR activity in 35S::pBVR3.

^dND: not detected.

Table 2. Primer sequences for RT-PCR.

AGI number	Common name	Primers (forward/reverse)
At1g08550	NPQ1	cttgcgcgttccttattgttcca/ttgcacgaatttttgtacggctga
At1g44575	NPQ4	ggctcaaaccatgctgcttacttca/agggcagatcggacgtttttgc
At1g29910-At1g29930	LHCB1.1-1.3/CAB1-3	gcctccacaatggctctct/cggggtaaagcaagtcctc
At5g25760	UBC21	ccttacgaaggcggtgtttttcag/cggcgaggcgtgtatacatttg
At5g60390	EF1	tagccgcaagactcctttcagattc/gatgtcctggggcatcaatgact

Figure 1. Growth and non-photochemical quenching (NPQ) phenotypes of No-0 wild-type (WT), constitutive inactivation of phytochrome line (35S::pBVR3), and mesophyll tissue-specific phytochrome inactivation lines (CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3]). Plants were grown under white light (100 µmol m⁻² s⁻¹) with a long-day photoperiod (16-h-light and 8-h-dark cycle) for 45 d. Before photographing, stems were removed from plants. Top panel: Bright light image of the Arabidopsis strains. Bottom panel: NPQ image of the Arabidopsis strains. In false-color NPQ image, white reflects the WT level of NPQ, whereas red reflects a low level of NPQ.

Figure 2. Measurement of photosynthetic properties of No-0 wild-type (WT), constitutive inactivation of phytochrome line (35S::pBVR3), and mesophyll tissue-specific phytochrome inactivation lines (CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3]). An attached, fully expanded rosette leaf (10th or 11th leaf) from a 30-d-old plant was used for each independent sample. Plants were grown in white light (100 µmol m⁻² s⁻¹) with a long-day photoperiod (16-h-light and 8-h-dark cycle). Before testing, plants were dark-adapted overnight. (a) NPQ as a function of light intensity (μmol m⁻² s⁻¹). (b) Energy-dependent exciton quenching (qE) as a function of light intensity (μmol m⁻² s⁻¹). (c) Photoinhibition (qI) as a function of light intensity (μmol m⁻² s⁻¹). (d) LEF (linear electron flow) as a function of light intensity (μmol m⁻² s⁻¹). (e) Maximal quantum yield of PSII (Fv/Fm). Data were presented as the mean ± SD (n = 5 or 6). (a–e) Unpaired, two-tailed Student’s t test comparing BVR lines to No-0 WT at each light intensity, *p < 0.05; red asterisks, CAB3::pBVR1 compared to WT; blue asterisks, CAB3::pBVR2 compared to WT; and gold asterisks, 35S::pBVR compared to WT. No symbols indicate no significant difference.

Figure 3. Chlorophyll content and ratio of chlorophyll a (Chl a) and chlorophyll b (Chl b) in No-0 wild-type (WT), 35S::pBVR3 (35S), CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3] lines. Extraction of chlorophyll with DMF (N,N-dimethylformamide) was performed using 10 mg of 30-d-old rosette leaves of plants as described in Figure 2. (a) Total chlorophyll. (b) Ratio of chl a and chl b (chl a/chl b). Data were presented as the means ± SD (n = 5). Unpaired, two-tailed Student’s t test comparing BVR lines with WT, *p < 0.005, **p < 0.0001.

Figure 4. Representative SDS-polyacrylamide gel electrophoresis and Western blot analyses of soluble proteins from No-0 wild-type (WT), 35S::pBVR3 (35S), CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3] lines. (Top panel) Total soluble proteins were extracted from 30-d-old plants (rosette leaves) grown under long-day condition. Proteins were resolved on 15% SDS-PAGE gel. Arrow indicated the proteins with reduced accumulation in CAB3-1 and CAB3-2 compared to WT and other lines. (Bottom panel) For Western blot analysis, anti-Lhcb1 antibody (Agrisera, AS01 004) was used.

Figure 5. Representative native green gel electrophoresis and Western blot analyses of thylakoid membrane-enriched fraction from No-0 wild-type (WT), 35S::pBVR3, CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3] lines. (a) Thylakoid membrane-enriched fractions were prepared using 80% percoll from 30-d-old plants. The solubilized proteins with 2% (v/v) octyl glucoside and 2% (v/v) decyl maltoside were subjected to native green gels. (b) Western blot analysis. Proteins associated with chlorophyll from native green gels were transferred to nitrocellulose membrane, and the membrane blot was subjected to immune reaction with anti-Lhcb1 antibody. Both arrow and arrowhead indicated Lhcb1 proteins associated with chlorophyll with different molecular mass.

Figure 6. Expression of NPQ-related genes in BVR lines. (a) RT-PCR analysis. Rosette leaves from 30-d-old plants of No-0 wild-type (WT), 35S::pBVR3, CAB3::pBVR1 [CAB3-1], CAB3::pBVR2 [CAB3-2], and CAB3::pBVR3 [CAB3-3] were used for RT-PCR analysis. As internal controls, a part of the UBC21 (At5g25760) or EF1 (At5g60390) was amplified in the same PCR reaction with NPQ1, NPQ4, or LHCB1.1-LHCB1.3 (to conserved region of LHCB1.1, LHCB1.2, and LHCB1.3) primers to demonstrate relative quantity and quality of the cDNA template. RT-PCR was repeated using two independent biological samples. (b,c) Heat map showing the expression of NPQ1, NPQ4, or LHCB1.1-LHCB1.3 in different Arabidopsis tissues (b) or different light conditions (c). For heat map, mean-normalized values from AtGenExpress expression library (www.weigelworld.org) and BAR Heatmapper Plus (bar.utoronto.ca) were used.