HOTAIR suppresses PTEN via DNMT3b and confers drug resistance in acute myeloid leukemia

Figures & data

Table 1. Primer and sequences for quantitative reverse transcription polymerase chain reaction.

Name of primer	Sequences
HOTAIR-F	CTCTCTCCCAACGACTCGAC
HOTAIR-R	CCGCAATGGTTGCGCTTTTA
PTEN-F	AGAACGTGGGAGTAGACGGA
PTEN-R	CTTGACACTTGCAACCAGGC
GAPDH-F	GCAAGGATGCTGGCGTAATG
GAPDH-R	TACGCGTAGGGGTTTGACAC

F, forward; R, reverse.

Table 2. Primers for methylmion-specific PCR.

Name of primer	Sequences
PTEN-M	Forward GGCGGCGGTCGCGGTTC
	Reverse GACTCCCCAAAACGCTAC
PTEN-U	Forward GTGTTGGTGGAGGTAGTTGTTT
	Reverse ACCACTTAACTCTAAACCACAACCA

PCR, polymerase chain reaction.

Figure 1. The expression of HOTAIR and PTEN in AML patients. RT-PCR was applied to measure the mRNA expressions of HOTAIR and PTEN in bone marrows of patients with AML and healthy controls. Compared with healthy controls, patients with AML had up-regulated expression of HOTAIR (A), but down-regulated expression of PTEN (B). The correlation analysis on HOTAIR and PTEN showed that HOTAIR expression was negatively correlated with PTEN (C). AML, acute myelocytic leukemia; HC, healthy controls; ND, patients with newly diagnosed AML; RE, patients with relapsed/refractory AML. *P < 0.05, **P < 0.01, n = 3.

Table 3. Clinical data of AML patients.

Variables	Newly diagnosed (ND) group	Relapsed/refractory (RE) group	Healthy-control (HC) group
Number of patients	19	11	20
Sex (male/female)	19/10	7/4	9/11
Age: median (range)	42 (19–68)	43 (21–73)	33 (18–49)
FAB Classification
M0	1	1	–
M1	1	0	–
M2	4	1	–
M3	3	2	–
M4	4	3	–
M5	5	3	–
M6	1	1	–
Hemoglobin (g/L): median (range)	78.5 (47.3–136.2)	58.3 (28.9–86.5)	–
WBC (×10^9/L): median (range)	34.6 (2.6–312.6)	17.9 (0.5–121.6)	–
PLT (×10^9/L): median (range)	44 (1–406)	301 (19–624)	–

Figure 2. AML-resistant cells had up-regulated HOTAIR and down-regulated PTEN. Up-regulated HOTAIR and down-regulated PTEN were found in AML-resistant cells. CCK-8 assay was applied to detect the cell viability of AML-sensitive cells HL60 and AML-resistant cells HL60/ADM after ADM treatment (A). IC₅₀ was accordingly calculated (B) to verify the sensitivity and resistance of AML cells. qRT-PCR and Western blot were applied to measure the expressions of HOTAIR (C) and PTEN (D and E). IC₅₀, half maximal inhibitory concentration; AML, acute myelocytic leukemia; ADM, adriacin doxorubicin. *P < 0.05, **P < 0.01, n = 3.

Figure 3. Knockdown of HOTAIR ameliorates AMD resistance in HL60/ADM cells. HL60/ADM cells were firstly transfected with sh-HOTAIR and pcDNA3.1-HOTAIR before qRT-PCR was applied to verify the transfection efficiency (A). CCK-8 assay showed that HOTAIR knockdown can suppress cell viability (B) and reduce IC₅₀ (C). After cell transfection, 2 μg/mL ADM treatment was conducted for HL60/ADM cells. Flow cytometry and clone formation assay showed that knockdown of HOTAIR results in increased cell apoptosis (D) and suppressed cell clones (E). qRT-PCR and Western blot were applied to measure the expressions of PTEN (F and G). IC₅₀, half maximal inhibitory concentration; AML, acute myelocytic leukemia; ADM, adriacin doxorubicin. *P < 0.05, **P < 0.01, n = 3.

Figure 4. Overexpression of PTEN enhances the sensitivity of HL60/ADM cells to ADM. HL60/ADM cells were transfected or co-transfected with pcDNA3.1-PTEN and pcDNA3.1-HOTAIR. Then qRT-PCR (A) and Western blot (B) showed mRNA expression of PTEN and protein expression of PTEN were elevated in response to transfection of pcDNA3.1-PTEN. Cell viability and IC₅₀ were determined by CCK-8 (C and D) to measure the effect of PTEN on cell viability. The effect of PTEN on cell apoptosis was determined by Flow cytometry (E) and on cell proliferation ability was detected by Colony formation assay (F).AML, acute myelocytic leukemia; ADM, adriacin doxorubicin. *P < 0.05, **P < 0.01, n = 3.

Figure 5. HOTAIR can up-regulate DNMT3b to suppress PTEN. HL60/ADM cells were transfected with sh-HOTAIR before RT-qPCR (A) and Western blot (B) were used to measure the expressions of DNMT3a and DNMT3b. The methylation in promoter of PTEN was verified by MSP (C) and quantified by BSP (D). MSP, Methylmion-specific PCR; BSP, Bisulfite Genomic Sequence; ADM, adriacin doxorubicin. *P < 0.05, **P < 0.01, n = 3.