Identification of two novel β-globin gene mutations HBB: exon3del, HBB: c.−81A>C

Figures & data

Figure 1. Family lineage chart.

Table 1. Hematological phenotypic analysis of Proband 1 and its family lineage.

Family members	Proband 1	Proband 1 sibling	Proband 1 father	Proband 1 mother
RBC/(×10^12/L)	3.15	5.90	6.76	5.61
Hb (g/L)	85.60	107.80	131.00	113.00
MCV (fl)	76.07	56.67	62.00	64.00
MCH (pg)	27.17	18.29	19.40	20.10
MCHC(g/L)	336.00	319.30	313.00	315.00
Hb A (%)	40.3	88.7	88.0	92.1
Hb A2 (%)	2.7	4.7	6.4	5.4
Hb F (%)	57.0	6.6	5.6	2.5

Figure 2. Family lineage chart.

Table 2. Hematological phenotypic analysis of Proband 2 and its family lineage.

Family members	Proband 2	Proband 2 father	Proband 2 mother
RBC/(×10^12/L)	3.76	6.92	5.80
Hb (g/L)	88.00	141.00	136.00
MCV (fl)	72.10	65.20	74.00
MCH (pg)	23.40	20.40	23.40
MCHC (g/L)	325.00	313.00	317.00
Hb A (%)	72.3	93.4	93.7
Hb A2 (%)	2.9	5.1	4.4
Hb F (%)	24.8	1.5	1.9

Table 3. Primer sequences and amplification fragments of HBB gene.

Primers	Sequence (5′-3′)	Amplification products
Promoter region and first exon	CCAAGCTGTGATTCCAAATATTACG	535
	GCAGAGAGAGTCAGTGCCTA
First exon and second exon	GACAGGTACGGCTGTCATCA	744
	TCATTCGTCTGTTTCCCATTC
Third exon	CATGCCTCTTTGCACCATTC	668
	TTAGCTGTTTGCAGCCTCAC

Figure 3. MLPA assay map of the mother of Proband 1 and controls (normal individuals without thalassemia). a. MLPA assay map of the mother of Proband 1 b. MLPA assay map of the mother of controls (normal individuals without thalassemia). The Proband 1's mother showed a 49% decrease in expression at the 166nt probe compared to the control, suggesting a heterozygote deletion. All are pointed out with arrows in the figure.

Figure 4. GAP-PCR results of Proband 1 and its family lineage: I. DNA Marker. II.a. From left to right, the second exon PCR results for Proband 1, Proband 1's father, and Proband's sibling. b. Proband 1’s mother exon 3 PCR results. c. Proband 1 exon 3 PCR results. Because Proband 1 is a double heterozygous mutation, the bar has multiple bars.

Figure 5. Sequencing map of Proband 1 and its family lineage. Figure 5: a. a sequencing map of the second exon of Proband 1, c.124_127delTTCT. b. a sequencing map of the second exon of Proband 1’s sibling, c.124_127delTTCT. c. a sequencing map of the second exon of Proband 1’s father, c.124_127delTTCT.d. a sequencing map of the third exon of Proband 1, exon3del. e. a sequencing map of the third exon of Proband 1’s mother, exon3del.

Figure 6. GAP-PCR results of Proband 2 and its family lineage. I. Figure 6: I: a. Proband 2 promoter region and exon 1 PCR results. b. Proband 2’s mother region and exon 1 PCR results. c. Proband 2 exon 2 PCR results. d. Proband 2’s father exon 2 PCR results. (DNA Marker same as Figure 4 I)

Figure 7. Sequencing map of Proband 2 and its family lineage. Figure 7. a. a sequencing map of the promoter region of Proband 2 with C/A at position 220 as c.−81A > C. b. a sequencing map of the second exon of Proband 2, c.124_127delTTCT.c. a sequencing map of the second exon of Proband 2’s father, c.124_127delTTCT. d. a sequencing map of the promoter region of Proband 2’s mother with C/A at position 220 as c.−81A > C.