Alleviation of thermal and overcrowding stress in finishing broilers by dietary propolis supplementation

Figures & data

Table 1. Ingredients and calculated and analysed compositions of the basal diets.

Item	Starter (0–21 d)	Finisher (22–42 d)
Ingredients, %
Corn	50.21	57.43
Soybean meal (48% CP)	36.25	28.20
Wheat gluten	5.00	5.00
Soybean oil	3.94	5.22
Limestone	1.20	1.32
Dicalcium phosphate	1.88	1.33
Salt	0.25	0.25
Choline chloride	0.08	0.08
Sodium bicarbonate	0.05	0.05
L-Lysine	–	0.08
DL-Methionine	0.14	0.04
Vitamin–mineral premix^a	1.00	1.00
	–	–
Calculated composition	–	–
Metabolizable energy, kcal/kg	3050	3200
Crude protein (N × 6.25)	23.00	20.00
Calcium, %	1.00	0.90
Available phosphorus, %	0.45	0.35
Lysine, %	1.13	1.01
Methionine + cystine, %	0.90	0.72
Threonine, %	0.86	0.74
Crude fibre	3.45	3.41

^a Vitamin and mineral premix supplied the following per kilogram of diet: vitamin A (from vitamin A acetate), 10,000 U; vitamin D₃, 9790 U; vitamin E (dl-α-tocopheryl acetate), 30 U; vitamin B₁₂, 20 μg; riboflavin, 4.4 mg; calcium pantothenate, 40 mg; niacin, 22 mg; choline,840 mg; biotin, 30 μg; thiamine, 4 mg; zinc sulphate, 60 mg; copper sulphate, 100 μg; selenium (sodium selenate), 0.2 mg; iodine, 1 mg; manganese oxide, 60 mg.

Table 2. Primers used for quantitative real-time PCR.

Target gene	Gene bank accession	Forward sequence (5′ to 3′)	Reverse sequence (5′ to 3′)
HSP70	NM_001006685	CGTCAGTGCTGTGGACAAGAGTA	CCTATCTCTGTTGGCTTCATCCT
β-Actin	NM_205518	ACTCTGGTGATGGTGTTAC	GGCTGTGATCTCCTTCTG

HSP70: heat shock protein 70.

Table 3. Effect of propolis supplementation and stocking density on the growth performance of broilers under heat stress from d 22 to 42.

Treatment^1	ADG, g	ADFI, g	Feed/gain
Thermoneutral (TN)
LSD	70.2^b	130.0^b	1.85^c
LSD + BG	76.5^a	137.2^a	1.79^c
Heat stress (HS)
LSD	58.6^c	113.5^c	1.94^b
LSD + BG	61.7^c	118.8^c	1.93^b
HSD	50.6^d	107.6^d	2.13^a
HSD + BG	57.4^c	115.3^c	2.00^b
SEM	6.35	12.92	0.12
p-Value for contrasts
TN vs. HS	<.001	<.001	.003
LSD vs. HSD	.006	<.001	.001
Basal diet vs. BG	.017	.022	.115

^a–dMeans that do not share common letters differ significantly (p < .05).

¹ The birds were either kept at thermoneutral zone (22 °C) or subjected to cyclic heat stress by exposing them to 32 °C for 10 h, from 0800 to 1800 h, and 22 °C from 1800 to 0800 h.

ADG: average daily gain; ADFI: average daily feed intake; LSD: low stocking density (10 birds/m²); HSD: high stocking density (18 birds/m²); BG: basal diet + propolis (4 g/kg of feed).

Table 4. Effect of propolis supplementation and stocking density on the coefficient of apparent ileal digestibility (CAID) of nitrogen (N), calcium (Ca) and phosphorus (P), and apparent metabolisable energy (AME) in broilers under heat stress at 35 d of age.

Treatment^1	CIAD of N	CAID of Ca	CAID of P	AME(Kcal/kg)
Thermoneutral (TN)
LSD	0.651^a	0.428	0.493	2,913^a
LSD + BG	0.642^a	0.412	0.516	2,886^a
Heat stress (HS)
LSD	0.522^b	0.437	0.488	2,634^b
LSD + BG	0.617^a	0.426	0.506	2,935^a
HSD	0.524^b	0.445	0.490	2,693^b
HSD + BG	0.625^a	0.432	0.497	2,897^a
SEM	0.031	0.032	0.026	62.3
p-Value for contrasts
TN vs. HS	.013	.176	.155	.054
LSD vs. HSD	.246	.205	.324	.114
Basal diet vs. BG	.029	.177	.146	.001

^a,b Means that do not share common letters differ significantly (p < .05).

¹ The birds were either kept at thermoneutral zone (22 °C) or subjected to cyclic heat stress by exposing them to 32 °C for 10 h, from 0800 to 1800 h, and 22 °C from 1800 to 0800 h.

LSD: low stocking density (10 birds/m²); HSD: high stocking density (18 birds/m²); BG: basal diet + propolis (4 g/kg of feed).

Table 5. Effect of propolis supplementation and stocking density on the immunity status of broilers under heat stress at 42 d of age.

	Relative weight, % of BW			Plasma immunoglobulin, ng/mL
Treatment^1	Spleen	Thymus	Bursa	IgG	IgM
Thermoneutral (TN)
LSD	0.129^a	0.391^a	0.186^a	941.17^b	27.35^b
LSD + BG	0.134^a	0.373^a	0.179^a	978.34^a	31.44^a
Heat stress (HS)
LSD	0.091^c	0.245^b	0.115^c	936.84^b	24.14^b
LSD + BG	0.119^b	0.238^b	0.146^b	968.54^a	25.37^b
HSD	0.095^c	0.253^b	0.122^c	981.75^a	29.45^a
HSD + BG	0.122^b	0.241^b	0.138^b	986.45^ab	29.32^a
SEM	0.045	0.038	0.011	12.27	1.31
p-Value for contrasts
TN vs. HS	.002	.006	<.001	.411	.127
LSD vs. HSD	.105	.314	.109	.022	.016
Basal diet vs. BG	.006	.258	.013	.002	.310

^a–cMeans that do not share common letters differ significantly (p < .05).

¹ The birds were either kept at thermoneutral zone (22 °C) or subjected to cyclic heat stress by exposing them to 32 °C for 10 h, from 0800 to 1800 h, and 22 °C from 1800 to 0800 h.

LSD: low stocking density (10 birds/m²); HSD: high stocking density (18 birds/m²); BG: basal diet + propolis (4 g/kg of feed).

Table 6. Effect of propolis supplementation and stocking density on the morphology of jejunum of broilers under heat stress at 42 d of age.

Treatment^1	Villus height, µm	Crypt depth, µm	V/C^2
Thermoneutral (TN)
LSD	817^b	214^b	3.82^a
LSD + BG	861^a	209^b	4.12^a
Heat stress (HS)
LSD	745^cd	228^a	3.27^b
LSD + BG	739^d	226^a	3.27^b
HSD	714^d	220^a	3.24^b
HSD + BG	773^c	231^a	3.34^b
SEM	17.4	4.6	0.126
p-Value for contrasts
TN vs. HS	<.001	<.001	<.001
LSD vs. HSD	.212	.177	.414
Basal diet vs. BG	.014	.324	.526

^a–dMeans that do not share common letters differ significantly (p <.05).

¹ The birds were either kept at thermoneutral zone (22 °C) or subjected to cyclic heat stress by exposing them to 32 °C for 10 h, from 0800 to 1800 h, and 22 °C from 1800 to 0800 h.

² V/C: villus height:crypt depth.

LSD: low stocking density (10 birds/m²); HSD: high stocking density (18 birds/m²); BG: basal diet + propolis (4 g/kg of feed).

Figure 1. Effect of propolis and stocking density on heat shock protein 70 mRNA (HSP70) expression of chicken breast in heat-stressed broilers. Values are mean ± SE (n= 5). Within the graph, bars with different letters (a–c) are significantly different (p <.05). LSD: low stocking density (10 birds/m²⁾, HSD: high stocking density (18 birds/m²), BG: basal diet + propolis (4 g/kg of feed)

Table 7. Effect of propolis supplementation and stocking density on stress indicators in broilers under heat stress at 42 d of age.

Treatment^1	Nitric oxide, µmol/L	Glucose, mmol/L	Cholesterol, mmol/L	Corticosterone, ng/mL	H/L^2
Thermoneutral (TN)
LSD	24.06^b	14.6	3.3	5.73^c	0.58^b
LSD + BG	24.41^b	13.9	3.1	5.22^d	0.66^a
Heat stress (HS)
LSD	25.33^b	15.2	3.6	6.38^b	0.45^c
LSD + BG	19.71^c	14.6	3.4	5.43^d	0.47^c
HSD	29.46^a	14.7	3.2	6.87^a	0.33^d
HSD + BG	21.20^c	15.0	3.2	5.41^d	0.48^c
SEM	1.726	0.42	0.07	0.174	0.026
p-Value for contrasts
TN vs. HS	.116	.414	.717	.114	.002
LSD vs. HSD	.012	.277	.230	.017	.033
Basal diet vs. BG	.005	.182	.504	.010	.042

^a–dMeans that do not share common letters differ significantly (p < .05).

¹ The birds were either kept at thermoneutral zone (22 °C) or subjected to cyclic heat stress by exposing them to 32 °C for 10 h, from 0800 to 1800 h, and 22 °C from 1800 to 0800 h.

² H/L: heterophil:lymphocyte.

LSD: low stocking density (10 birds/m²): HSD: high stocking density (18 birds/m²); BG: basal diet + propolis (4 g/kg of feed).