Effects of selenium supplementation on growth performance, selenium content and gene expression in pigeon squabs

Figures & data

Table 1. Composition of basal diet.

Ingredient	Content (% on DM)
Wheat	8
Corn	50
Pea	35
Sorghum	6
Supplemental sand	1
ME, MJ/kg	11.97
Crude protein, %	15.02
Calcium, %	0.43
Total phosphorus, %	0.35
Lysine, %	0.90
Methionine, %	0.45

Table 2. Composition and nutrient levels of the supplemental sand.

Ingredients	Content (%)
CaHPO4	17
Shell meal	17
Medium coarse sand	38
NaCl	5
Premix^1	20
Strong complement vitamin2	2
Cod-liver oil3	1
Calcium, %	10.84
Phosphorus, %	3.87
Lysine, %	0.07

¹⁾Premix provided the following per kg of supplemental sand: vitamin A, 250000 IU; vitamin D_3, 82500 IU; vitamin E, 300 IU; vitamin K, 40 mg; vitamin B₁, 20 mg; vitamin B₂, 170 mg; pantothenic acid calcium, 1000 mg; nicotinic acid, 650 mg; vitamin B₆, 160 mg; vitamin B₁₂, 100 mg; biotin, 40 mg; Fe, 1200 mg; Cu, 160 mg; Zn, 66 mg; Mn, 1320 mg; Se, 6 mg; I, 20 mg.

²⁾Strong complement vitamin provided the following per kg of supplemental sand: vitamin A, 640000 IU; vitamin D₃, 60000 IU; vitamin E, 130 IU; vitamin K₃, 50 mg; vitamin B₁, 30 mg; vitamin B₂, 60 mg; pantothenic acid calcium, 300 mg; nicotinic acid, 700 mg; vitamin B_6, 40 mg; vitamin B₁₂, 0.1 mg.

³⁾Cod-liver oil provided the following per kg of supplemental sand: vitamin A, 300000 IU; vitamin D₃, 30000 IU; vitamin E, 300 IU; vitamin C, 1 g.

Table 3. Primer sequences of target genes and GAPDH gene.

Gene	5' - 3'	Length (bp)	Accession number
GPx4	F：CCGCTCTGGAAGTGGATG R：GGACCTGGCTTGAAGACAAA	168	XM_005509302
GH	F：TCCCAGCTCCCACGGGGAAG R：TGAAAACCGAAGCAGCTCC	156	EF521464
GAPDH	F：CTCTACTCATGGCCACTTCCG R：ACAACGTATTCAGCACCAGC	138	NM_001282835

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Table 4. Effect of dietary SS supplementation on the growth performance of squabs.

Item	Level of SS (mg/kg)				SEM	P-value
	T1	T2	T3	T4		ANOVA	Linear	Quadratic
1-7d
N	90	90	90	90
BW at 1d, g/bird	15.42	15.50	15.93	15.41	0.22	0.81	0.83	0.46
BW at 7d, g/bird	188.60	182.99	185.99	186.07	3.00	0.93	0.89	0.57
BWG, g/bird	173.18	167.75	170.05	170.66	3.00	0.95	0.88	0.48
8-14d
N	90	90	90	90
BW at 14 d, g/bird	385.11^a	347.83^b	353.44^b	342.15^b	4.01	0.001	<0.01	0.13
BWG, g/bird	196.50^a	164.84^b	167.45^b	156.08^bc	4.55	0.009	0.01	0.28
15-21d
N	90	90	90	90
BW at 21d, g/bird	452.43^a	493.85^b	488.13^b	478.54^b	4.71	0.009	<0.01	0.03
BWG, g/bird	67.32^a	146.02^c	134.69^c	136.39^c	6.28	<0.001	<0.01	<0.01
22-28d
N	90	90	90	90
BW at 28 d, g/bird	499.62	507.66	495.85	527.66	6.20	0.29	0.11	0.33
BWG, g/bird	50.42	17.46	13.97	39.21	8.05	0.32	0.53	0.14

SS: sodium selenite; N: Number; BW: Body weight; BWG: Body weight gain; T1: Treatment 1; T2: Treatment 2; T3: Treatment 3; T4: Treatment 4.The different letters indicate the difference were significant (adjacent for P < 0.05; interval for P < 0.001).

Table 5. Effects of dietary SS supplementation on muscle Se concentration of squabs (Means ± SD) (mg/kg).

Treatment	Chest muscle	Leg muscle
T1	0.12 ± 0.002^a	0.11 ± 0.023^a
T2	0.14 ± 0.011^b	0.13 ± 0.046^b
T3	0.17 ± 0.015^bc	0.15 ± 0.034^bc
T4	0.20 ± 0.073^c	0.19 ± 0.012^c

SS: sodium selenite; T1: Treatment 1; T2: Treatment 2; T3: Treatment 3; T4: Treatment 4.^a-cMeans different superscripts indicate significantly different values (P < 0.05).

Figure 1. Relative (2^-ΔΔCT) of expression levels of GPx4 in tissues of squabs supplemented with dietary SS. Values marked with different letters on the bars are significantly different (P < 0.05).

Figure 2. Relative (2^-ΔΔCT) of expression levels of GH in tissues of squabs supplemented with dietary SS.

Adams TE, Baker L, Fiddes RJ, Brandon MR. 1990. The sheep growth hormone receptor: molecular cloning and ontogeny of mRNA expression in the liver. Mol Cell Endocrinol. 73:135–145.

 PubMed Web of Science ®Google Scholar