Stimulatory effects of fish oil and vitamin E on ovarian function of laying hen

Figures & data

Table 1. The major fatty acid profiles of oil and basal diet (% of total fatty acids).

Fatty acid	Basal diet	Sunflower oil	Fish oil
C14:0	0.08	0.06	2.58
C14:1	–	–	0.29
C15:0	–	–	0.63
C15:1	–	–	0.15
C16:0	6.70	12.50	18.07
C16:1	0.12	0.20	6.31
C17:0	0.09	0.10	1.47
C17:1	0.08	0.04	1.02
C18:0	3.89	3	5.46
C18:1t	–	–	0.23
C18:1c	30.47	29.33	29.65
C18:2t	0.03	–	0.22
C18:2c	56.08	49.93	2.94
C18:3 n-6	–	0.02	0.20
C18:3 n-3	–	2.31	2.12
C20:0	0.32	0.57	0.33
C20:1	0.29	0.47	2.64
C21:0	–	0.01	–
C20:2	–	–	0.10
C22:0	0.93	0.28	0.33
C20:3 n-3	–	–	0.78
C20:4 n-6	–	0.03	0.07
C22:2	0.03	0.10	1.04
C24:0	0.33	0.28	0.13
C24:1	0.01	0.01	1.56
C20:5 n-3 EPA	–	–	6.22
C22:6 n-3 DHA	–	0.05	14.27
Other fatty acids	0.55	0.71	1.19

Table 2. The characteristic of primers used in real-time RT-PCR assays.

Accession number	Target gene	Primer sequence	Product size (bp)
NM_204305.1	GAPDH	Forward: AGAAACCAGCCAAGTATGATGA Reverse: CTGTCACCATTGAAGTCACAG	121
NM_001030920.1	Bak	Forward: ATCAATGCAGAGGACCAGGTG Reverse: CGTACCGCTTGTTGATGTCG	208
NM_205339.2	Bcl-2	Forward: GATGACCGAGTACCTGAACC Reverse: CAGGAGAAATCGAACAAAGGC	114
NM_204725.1	Cas3	Forward: GAACTGAAAGTACTAACCAGCC Reverse: GTCCACTGTCTGCTTCAATAC	130
NM_204592.2	Cas8	Forward: TATGTCTCCTACAGAAGCCCAA Reverse: GTCAATCTTGCTGCTCACCT	141
XM_424580.5	Cas9	Forward: ACCTGGCTGACATGCTGGAT Reverse: TGCTCACACTTTTGTCACGCC	111

GAPDH: glyceraldehyde-3-phosphate dehydrogenase; Bak: BCL-2 antagonist/killer; Bcl-2: BCL-2 apoptosis regulator, Cas3: caspase 3, Cas8: caspase 8; Cas9: caspase 9.

Figure 1 Effects of dietary treatments on the rate of ovulation (hen-day egg production %). The rate of ovulation was 89.57, 91.08, 92.14 and 95.89% in control, E, n-3 + E and n-3 treatments, respectively. Experimental groups (n = 17 in each group): basal diet +1.5% sunflower oil (control; C); basal diet +1.5% sunflower oil +1.1 U alpha-tocopherol/hen/day (E); basal diet+ 1.5% fish oil +1.1 U alpha-tocopherol/hen/day (n-3 + E) and basal diet +1.5% fish oil (n-3). Data are presented as means ± SEM (^a,bGroups followed by the same letter are not significantly different at the p < .05).

Table 3. Effects of diets on different reproductive morphology parameters in laying hens.

Group	Control	E	n-3 + E	n-3	SEM	p-value
Body Weight, g	1544.50	1547.40	1555.70	1551.10	16.25	0.990
Oviduct Weight, g	56.10	55.50	58.70	57.30	0.90	0.610
Oviduct Weight, %BW	3.64	3.60	3.80	3.70	0.07	0.830
Oviduct Length, mm	51.00	51.60	51.90	52.10	0.38	0.760
Ovary Weight, g	41.10^b	41.40^b	44.60^a	44.00^a	0.45	0.004
Ovary Weight, %BW	2.67	2.68	2.88	2.84	0.04	0.136
SYF, n.	10.30^c	12^b	12.90^ab	13.70^a	0.31	p<.001
LYF, n.	4.40^b	4.70^b	5.60^a	5.90^a	0.15	p<.001
LWF, n.	16.70	16.90	17.10	17.30	0.16	0.610
Total follicles, n.	31.40^c	33.60^b	35.60^a	36.90^a	0.48	p<.001
F1 Weight, g	12.30	12.40	12.60	12.70	0.20	0.900

Values are given as mean ± SEM. Means in bold were significant and groups followed by the same letter are not significantly different. Experimental diet: basal diet +1.5% sunflower oil (control;C); basal diet +1.5% sunflower oil +1.1 U alpha-tocopherol /hen/day (E); basal diet+ 1.5% fish oil +1.1 U alpha-tocopherol /hen/day (n-3 + E) and basal diet +1.5% fish oil (n-3). LYF: large yellow follicle (≥10 mm diameter); SYF: small yellow follicle (5 to 10 mm diameter); LWF: large white follicle (3 to 5 mm diameter); Total follicle: SYF+ LYF+ LWF; F1: the largest yellow follicle.

Figure 2 The percentage of intact primordial, primary and prehierarchical follicles in different experimental groups (n = 10 in each group): basal diet +1.5% sunflower oil (control; C); basal diet +1.5% sunflower oil +1.1 U alpha-tocopherol/hen/day (E); basal diet+ 1.5% fish oil +1.1 U alpha-tocopherol/hen/day (n-3 + E) and basal diet +1.5% fish oil (n-3). Values are given as mean ± SEM. Groups followed by the same letter are not significantly different at p < .05.

Figure 3 Laying hen ovarian tissues (n = 10 in each group). Intact primordial follicles (dash arrows) and atretic primordial follicles (arrow head). A: Control (basal diet), B: Vitamin E, C: n-3 + E, D: n-3. Basal diet +1.5% sunflower oil (control; C); basal diet +1.5% sunflower oil + 1.1 U alpha-tocopherol/hen/day (E); basal diet + 1.5% fish oil + 1.1 U alpha-tocopherol/hen/day (n-3 + E) and basal diet + 1.5% fish oil (n-3). Hematoxylin & Eosin staining (scale bar = 100 μm). Follicles with a maximum size of 80 μm were counted as primordial follicles. (Only the follicles with a visible nucleus were counted).

Table 4. Effect of dietary treatments on fatty acid concentration of blood serum (% of total fatty acids).

Item	Control	E	n-3 + E	n-3	SEM	p-value
C14:0	0.28	1.20	0.13	0.17	0.19	.120
C14:1	0.04	0.50	0.12	0.12	0.08	.191
C15:0	0.11	0.21	0.14	0.09	0.04	.764
C15:1	0.15	0.17	0.13	0.10	0.03	.902
C16:0	21.20	21.80	20	20.70	0.79	.893
C16:1	2.30	2.80	3.50	2.30	0.28	.384
C17:0	0.21	0.70	0.50	0.40	0.13	.675
C17:1	0.16	0.29	0.12	0.20	0.03	.096
C18:0	14.30	11.40	11.50	12.30	0.85	.597
C18:1t	0.16	0.30	0.14	0.10	0.08	.876
C18:1c	33.30	28	32.30	31	1.08	.282
C18:2t n-6	0.18	1.30	0.12	0.67	0.22	.172
C18:2c n-6	16.70^a	15.06^a	11.40^b	10.50^b	0.82	.004
C20:0	0.34	0.08	0.14	0.24	0.05	.181
C18:3 n-6	0.13	0.41	0.16	0.50	0.09	.370
C18:3 n-3	0.32	0.42	0.30	0.25	0.07	.888
C20:1	0.23	0.05	0.09	0.67	0.09	.055
C21:0	0.29	0.88	0.22	0.06	0.18	.441
C20:2	0.14	0.50	0.12	0.40	0.10	.505
C22:0	0.04	0.16	0.30	0.20	0.05	.502
C20:3 n-6	2.41	1.60	2.70	0.10	0.61	.802
C22:1	0.30	0.24	0.28	0.11	0.07	.843
C20:3 n-3	0.27	0.38	0.32	0.20	0.04	.650
C20:4 n-6	2.96^a	0.98^b	0.82^b	1^b	0.32	.020
C22:2	0.18	0.75	0.26	0.30	0.12	.301
C24:0	0.16	0.12	0.18	0.01	0.04	.446
C20:5 n-3EPA	0.16^b	0.06^b	0.30^b	1.20^a	0.16	.038
C24:1	0.19	0.80	0.20	0.24	0.13	.346
C22:5n3	0.08	0.30	0.24	0.35	0.05	.308
C22:6 n-3DHA	1.06^b	1.40^b	5.80^a	7.60^a	0.90	.007
Saturated	36.80	35.80	32.60	33.80	0.92	.367
MUFA	36.70	33.10	37.60	35	1.15	.558
PUFA	25.30	24	22.93	24.40	1.04	.900
Σn-3	1.90^b	2.50^b	7^a	9.60^a	1.01	.005
Σn-6	6.10	3.80	4.02	3.01	0.60	.323
n-3/n-6	0.30^b	1.60^ab	1.70^ab	3.60^a	0.47	.050

t: trans; c: cis; EPA: Eicosapentaenoic acid; DHA: Docosahexaenoic acid; MUFA: Monounsaturated fatty acid; PUFA: Polyunsaturated fatty acid. Values are given as mean ± SEM. Means in bold were significant. ^a,bGroups followed by the same letter are not significantly different at the p < .05. Experimental treatments include basal diet +1.5% sunflower oil (control;C); basal diet +1.5% sunflower oil +1.1 U alpha-tocopherol /hen/day (E); basal diet+ 1.5% fish oil +1.1 U alpha-tocopherol /hen/day (n-3 + E) and basal diet +1.5% fish oil (n-3).

Figure 4 Fold change of Bak, Bcl-2, Caspase 3, Caspase 8, and Caspase 9 in experimental groups (n = 6 in each group): basal diet +1.5% sunflower oil (control; C); basal diet +1.5% sunflower oil +1.1 U alpha-tocopherol/hen/day (E); basal diet+ 1.5% fish oil +1.1 U alpha-tocopherol/hen/day (n-3 + E) and basal diet +1.5% fish oil (n-3). Values are given as mean ± SEM. Groups followed by the same letter are not significantly different at p < .05.