Productive performance, egg-related indices, blood profiles, and interferon-Ɣ gene expression of laying Japanese quails fed on Tenebrio molitor larva meal as a replacement for fish meal

Figures & data

Table 1. Analysis of the mealworm larvae (Tenebrio molitor) and fish meal, g/kg as fed.

	Mealworm larvae	Fish meal
Total protein	464.40	639.00
Ash	–	13.90
Ether extract	–	10
Arginine	22.28	–
Histidine	13.79	–
Isoleucine	18.29	–
Leucine	31.28	–
Lysine	25.04	–
Methionine	5.22	–
Cysteine	6.67	–
Phenylalanine	15.44	–
Threonine	17.03	–
Valine	25.74	–
Calcium	0.43	20.50
Total phosphorus	7.06	34.50

Table 2. Dietary composition and nutrients.

	Experimental diet^a
Items	CTL	M25	M50	M75	M100
Ingredients (g/kg)
Corn (80 g/kg crude protein)	544.6	538.8	534.9	530.0	525.3
SBM (440 g/kg crude protein)	315.0	320.0	325.0	330.0	335.0
Fish meal (639 g/kg crude protein)	30	22.5	15.0	7.5	0.0
TM meal (464 g/kg crude protein)	0	7.5	15.0	22.5	30.0
Soybean oil	35.0	33.5	32.0	30.5	29.0
Dicalcium phosphate	9.9	11.9	11.8	12.7	13.6
Calcium carbonate	54.3	54.6	54.9	55.3	55.6
^DL-Methionine	0.6	0.6	0.7	0.8	0.8
Choline	2.0	2.0	2.0	2.0	2.0
Vitamin and mineral premix^b	5.0	5.0	5.0	5.0	5.0
Sodium chloride	2.0	2.0	2.0	2.0	2.0
NaHCo3	1.6	1.6	1.7	1.7	1.7
Calculated nutrient level (as fed basis)
ME (Kcal/kg)	2900	2900	2900	2900	2900
Crude protein (g/kg)	200	200	200	200	200
Lysine (g/kg)	10.2	10.2	10.2	10.2	10.2
Met + Cys (g/kg)	7.0	7.0	7.0	7.0	7.0
Threonine (g/kg)	7.6	7.6	7.6	7.6	7.6
Arginine (g/kg)	12.7	12.7	12.7	12.6	12.6
Valine	9.7	9.7	9.7	9.7	9.7
Isoleucine	8.6	8.6	8.6	8.6	8.6
Tryptophan	2.3	2.3	2.3	2.3	2.3
Sodium	1.5	1.5	1.5	1.5	1.5
Chloride	1.8	1.8	1.8	1.8	1.8
Calcium (g/kg)	2.5	2.5	2.5	2.5	2.5
Available phosphorous (g/kg)	3.5	3.5	3.5	3.5	3.5
Analysed value
Calcium (g/kg)	2.53	2.57	2.54	2.53	2.60
Total phosphorous (g/kg)	5.63	5.45	5.57	5.53	5.47

SBM: Soybean meal; TM meal: Tenebrio molitor larva meal; ME: metabolisable energy.

^aCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal.

^bVitamin premix provided per kg of diet: vitamin A (retinol), 11000 U; vitamin D3 (Cholecalciferol), 2300 U; vitamin E (tocopheryl acetate), 22 U; vitamin k3, 2 mg; thiamine 3 mg; riboflavin, 40 mg; pantothenic acid, 18 mg; pyridoxine, 4 mg; cyanocobalamin, 0.017 mg; niacin, 65 mg; biotin, 0.3 mg; folic acid, 0.075 mg; choline chloride, 600 mg; antioxidant 100 mg; Mineral premix provided per kg of diet: Fe (FeSO₄·7H2O, 20.09% Fe), 80 mg; Mn (MnSO4·H₂O, 32.49% Mn), 100 mg; Zn (ZnO, 80.35% Zn), 60 mg; Cu (CuSO₄·5H₂O), 8 mg; I (KI, 58% I), 0.5 mg; Se (NaSeO₃, 45.56% Se), 0.15 mg.

Table 3. Primers used for quantitative real-time PCR.

Target gene	Gene bank accession	Forward sequence (5′ to 3′)	Reverse sequence (5′ to 3′)
INF-ɣ	NM_205149	CTGGCAVVTAGCACAATGAA	TGCTTGCTGATCCATCT
ß-actin	NM_205518	AACAACCTTAATGATGGCACG	GCATCTCCTCAAACACTGGTCT

Table 4. Egg production variables of laying quails.

	Experimental treatments^e					SEM	p-value
Parameters	CTL	M25	M50	M75	M100
Feed intake (g/d)
1 to 5 week	27.19^b	27.02^c	25.27^d	24.63^e	27.96^a	0.032	<.001
Egg mass
1 to 5 week	11.62^a	10.90^b	11.13^ab	11.04^b	11.14^ab	0.341	<.001
FCR (g/g)
1 to 5 week	2.34^ab	2.48^a	2.27^b	2.23^b	2.51^a	0.059	.001
Egg weight (g)
1 to 5 week	11.91	11.47	11.65	11.66	11.74	0.245	.38

^a,b,c,dMeans in the same row with different superscript differ significantly (p < .05).

^eCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal; FCR: feed conversion ratio.

Table 5. Egg qualitative indices of laying quails.

	Experimental treatments^c					SEM	p-Value
Parameters	CTL	M25	M50	M75	M100
Yolk weight (g)
Week 1	3.15^a	2.62^b	3.24^a	3.16^a	3.13^a	0.133	<.001
Week 2	3.63	3.33	3.39	3.17	3.38	0.226	.052
Week 3	3.94	3.82	3.96	3.79	3.95	0.171	.067
Week 4	4.04	3.68	3.74	3.97	3.96	0.126	.122
Week 5	3.97	3.66	3.51	3.61	3.89	0.194	.135
Yolk diameter
Week 1	0.415	0.430	0.427	0.422	0.414	0.008	.112
Week 2	0.436	0.443	0.508	0.448	0.435	0.027	.090
Week 3	0.462	0.470	0.455	0.452	0.450	0.007	.170
Week 4	0.457	0.443	0.459	0.453	0.450	0.008	.060
Week 5	0.446	0.445	0.454	0.458	0.431	0.012	.190
Yolk height
Week 1	0.188	0.190	0.183	0.181	0.184	0.006	.112
Week 2	0.186^ab	0.191^ab	0.176^b	0.182^b	0.202^a	0.005	.003
Week 3	0.186^a	0170^b	0.174^ab	0.177^ab	0.174^ab	0.003	.027
Week 4	0.178	0.176	0.178	0.186	0.174	0.003	.091
Week 5	0.446	0.445	0.454	0.458	0.431	0.012	.087
Albumen weight (g)
Week 1	5.96	6.26	6.004	6.12	7.06	0.043	.145
Week 2	6.55	6.64	6.83	6.87	6.14	0.322	.089
Week 3	6.06	6.52	6.44	6.57	6.50	0.206	.059
Week 4	6.54	6.37	6.45	6.31	6.49	0.191	.065
Week 5	6.71	6.81	6.83	7.05	6.60	0.194	.068
Shell weight (g)
Week 1	1.30	1.28	1.34	1.33	1.35	0.062	.133
Week 2	1.58	1.49	1.44	1.42	1.43	0.069	.255
Week 3	1.64^a	1.57^ab	1.46^ab	1.42^b	1.53^ab	0.069	.011
Week 4	1.45	1.50	1.45	1.46	1.53	0.045	.455
Week 5	1.47	1.49	1.44	1.55	1.62	0.082	.110

^a,bMeans in the same row with different superscript differ significantly (p < .05).

^cCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal.

Table 6. Serum biochemical parameters of laying quails.

	Experimental treatments^c					SEM	p-Value
Parameters	CTL	M25	M50	M75	M100
Total protein (g/dL)	5.56	4.19	4.49	5.47	4.05	3.795	.629
Albumin (g/dL)	2.33	1.88	1.88	2.24	1.82	0.804	.520
Globulin (g/dL)	3.23	2.31	2.61	3.23	2.23	0.850	.257
A/G	0.99	0.94	0.99	0.87	0.83	0.085	.322
Uric acid (mg/dL)	3.71	4.62	4.150	4.90	5.34	0.545	.557
Cholesterol (mg/dL)	249.82^a	308.71^a	281.59^a	182.58^b	176.20^b	34.547	.030
Triacylglycerol (mg/dL)	233.48	271.54	261.32	202.11	240.35	32.009	.220
HDL (mg/dL)	106.71	111.69	91.36	104.84	100.70	8.037	.250
Calcium (mg/dL)	4.92^ab	4.53^ab	3.58^b	5.79^a	4.68^ab	0.524	.033
Phosphorous (mg/dL)	7.28	6.96	6.67	6.17	6.96	0.340	.180

HDL: high-density lipoprotein.

^a,bMeans in the same row with different superscript differ significantly (p < .05).

^cCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal.

Table 7. Haematological traits of laying quails.

	Experimental treatments^a					SEM	p-Value
Parameters	CTL	M25	M50	M75	M100
Haematocrit (%)	54.80	49.60	51.20	45.40	45.80	3.207	.670
RBC (mmol ×10^6)	5.06	4.46	4.46	4.00	4.04	0.350	.559
Haemoglobin (g/dl)	18.28	16.58	17.02	15.14	15.26	1.068	.217
WBC (mmol ×10^3)	20.28	20.27	19.03	19.72	21.15	1.030	.870
Heterophil (%)	24.00	24.60	30.60	26.40	24.20	2.929	.480
Lymphocyte (%)	70.80	68.40	66.20	67.00	70.60	2.821	.660
Monocyte (%)	3.20	3.20	3.50	3.40	3.40	0.456	.520
Eosinophil (%)	11.40	12.40	13.00	12.20	11.60	0.322	.640
Basophil (%)	0.80	0.40	1.20	0.80	0.20	0.322	.330

^aCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal.

Table 8. Effect of experimental treatments on mRNA expression of INF-ɣ gene.

	Experimental treatments^a					SEM	p-Value
Item	CTL	M25	M50	M75	M100
mRNA expression	1.11	0.57	0.80	1.03	0.81	0.21	.187

^aCTL: a basal diet; M25: a basal diet supplemented with 25% (7.5 g/kg) Tenebrio molitor meal in replace of fish meal; M50: a basal diet supplemented with 50% (15 g/kg) Tenebrio molitor meal in replace of fish meal; M75: a basal diet supplemented with 75% (22.5 g/kg) Tenebrio molitor meal in replace of fish meal; M100: a basal diet supplemented with 100% (30 g/kg) Tenebrio molitor meal in replace of fish meal.