Genome-wide identification and characterisation of long non-coding RNAs in two Chinese cattle breeds

Figures & data

Table 1. Primers used in the qPCR analysis.

Gene name	Forward primer	Reverse primer	Product size, bp	Tm, °C
MSTRG.5226.1	ttctggaccatggagaggag	cggcagcagaggagagag	187	60.1
MSTRG.11027.1	gccaagcacttcaaacatca	ctccaccatccaatctgtcc	231	60.1
MSTRG.2792.1	cttaggctgcctgtcattcc	gccgccttcttcagtgtatc	264	59.8
MSTRG.5551.1	tggtcttggtgcctgtgg	ggaggaggaggaggctgt	297	60.5
MSTRG.6194.7	agctgtcagagcatccgagt	gctgcctgctctctttcagt	257	60.0
MSTRG.8585.2	ttcgaagcagcagagtcaga	atagaacggcgtggaaaatg	283	60.0
GAPDH	cgaccactttgtcaagctca	tctcagtgtggtggagatgg	288	59.8

Table 2. Summary of reads mapping to the bovine transcriptomes.

Sample	CH1	CH2	CH3	TJ1	TJ2	TJ3
Number of raw data	82,371,264	81,802,544	80,607,132	82,070,242	81,279,218	81,334,728
Number of raw base (Gb)	12.36	12.27	12.09	12.31	12.19	12.20
% Clean data Q20	97.45%	97.43%	97. 23%	97.67%	97. 30%	97. 19%
% Clean data Q30	93.80%	93.72%	93.37%	94. 26%	93.47%	93.25%
% GC Content	50.71%	49.72%	49. 20%	49.40%	49. 30%	48.70%
Number of total Clean Reads	81,942,408	81,707,456	80,541,884	81,856,618	80,933,636	81,284,746
% total clean reads	99.48%	99.88%	99.92%	99.74%	99.57%	99.94%
Number of mapped reads	77,677,753	77,738,137	76,483,186	77,508,940	76,522,548	76,667,123
% mapped reads	94.80%	95. 14%	94.96%	94.69%	94.55%	94. 32%
Number of uniquely mapped reads	54,295,039	55,699,972	54,921,510	54,131,781	53,092,465	53,330,921
% uniquely mapped reads	66. 26%	68. 17%	68. 19%	66. 13%	65.60%	65.61%

CH: Charolais; TJ: Tongjiang.

Figure 1. Profile of lncRNA characteristics. (a) Summary of lncRNA types (b) The number of lncRNAs detected on each chromosome (c) The length distribution of lncRNAs (d) Exon number distribution of lncRNAs.

Figure 2. Analyses of differentially expressed lncRNAs between Charolais cattle and Tongjiang cattle. (a) Venn diagram of expressing lncRNAs in both CH and TJ breeds (b) PCA score plot of six samples. CH: Charolais; TJ: Tongjiang.

Table 3. The GO term and KEGG functional annotation of genes nearby lncRNAs.

Ontology	Term	Description	Folder E.	p Value
BP	GO:0021987	Cerebral cortex development	4.39	.00
	GO:0035914	Skeletal muscle cell differentiation	3.52	.01
	GO:0043406	positive regulation of MAP kinase activity	3.96	.01
	GO:0050852	T cell receptor signalling pathway	3.85	.01
	GO:0048565	Digestive tract development	4.24	.01
	GO:0006783	Heme biosynthetic process	6.59	.02
	GO:0042733	Embryonic digit morphogenesis	3.22	.02
	GO:0007507	Heart development	2.18	.02
	GO:0046513	Ceramide biosynthetic process	4.49	.02
	GO:0021766	Hippocampus development	3.60	.02
	GO:0002062	Chondrocyte differentiation	3.60	.02
	GO:0007156	Homophilic cell adhesion via plasma membrane adhesion molecules	2.24	.02
	GO:0030335	Positive regulation of cell migration	2.02	.03
	GO:0048041	Focal adhesion assembly	5.65	.03
	GO:0007411	Axon guidance	2.25	.03
	GO:0035690	Cellular response to drug	3.21	.04
	GO:0007286	spermatid development	2.51	.04
	GO:0035019	somatic stem cell population maintenance	3.80	.04
	GO:0007157	Heterophilic cell–cell adhesion via plasma membrane cell adhesion molecules	3.04	.05
	GO:0043117	Positive regulation of vascular permeability	8.48	.05
	GO:0032836	Glomerular basement membrane development	8.48	.05
	GO:0030814	Regulation of cAMP metabolic process	8.48	.05
	GO:0006198	cAMP catabolic process	8.48	.05
CC	GO:0005911	Cell–cell junction	2.72	.00
	GO:0042629	Mast cell granule	7.12	.02
	GO:0045211	Postsynaptic membrane	2.13	.03
	GO:0042734	Presynaptic membrane	3.76	.04
	GO:0031256	Leading edge membrane	8.39	.05
	GO:0000164	Protein phosphatase type 1 complex	8.39	.05
	GO:0008076	Voltage-gated potassium channel complex	2.41	.05
MF	GO:0005057	Receptor signalling protein activity	8.01	.00
	GO:0030552	cAMP binding	5.27	.01
	GO:0003823	Antigen binding	4.77	.02
	GO:0004879	RNA polymerase II transcription factor activity, ligand-activated sequence-specific DNA binding	4.17	.03
	GO:0008603	cAMP-dependent protein kinase regulator activity	10.01	.03
	GO:0005201	Extracellular matrix structural constituent	3.25	.04
	GO:0005546	Phosphatidylinositol-4,5-bisphosphate binding	3.16	.04
	GO:0004115	3′,5′-cyclic-AMP phosphodiesterase activity	8.58	.04
KP	bta04540	Gap junction	3.03	.00
	bta04910	Insulin signalling pathway	2.16	.02
	bta05215	Prostate cancer	2.57	.02
	bta04931	Insulin resistance	2.21	.04
	bta04724	Glutamatergic synapse	2.17	.04

BP: biological process; CC: cellular component; MF: molecular function; KP: KEGG pathway; Folder E.: folder enrichment.

Figure 3. Validation of six differentially expressed lncRNAs by qPCR. Data are the mean ± SEM. *p<.05; **p<.01.