Artemisia annua L. aqueous extract as an alternative to antibiotics improving growth performance and antioxidant function in broilers

Figures & data

Table 1. Composition and nutrient levels of the basal diet (as-fed basis), %.

Items	1–21, d of age	22–42, d of age
Ingredients
Corn	52.50	58.80
Soybean meal	40.00	33.80
Soybean oil	3.00	3.00
Dicalcium phosphate	1.90	1.80
Limestone	1.08	1.22
Salt	0.37	0.37
Lysine	0.05	0.03
Methionine	0.19	0.07
Premix^a	0.80	0.80
Choline	0.11	0.11
Total	100.00	100.00
Nutrient levels^b
Metabolizable energy (Mega joule/kg)	12.42	12.62
Crude protein	21.77	19.65
Calcium	1.00	1.02
Available phosphorus	0.44	0.42
Lysine	1.34	1.15
Methionine	0.55	0.40
Cysteine	0.40	0.36

^a Premix provided the following per kilogram of diet: vitamin A 9000, IU, vitamin D3 3 000 IU, vitamin E 26 mg, vitamin K3 1.20 mg, vitamin B1 3.00 mg, vitamin B2 8.00 mg, vitamin B6 4.40 mg, vitamin B12 0.012 mg, nicotinic acid 45 mg, folic acid 0.75, mg, biotin 0.20, mg, choline 1100, mg, calcium pantothenate 15, mg. Fe 100, mg, Cu 10, mg, Zn 108, mg, Mn 120, mg, I 1.5, mg, Se 0.35, mg.

^b Crude protein was measured value, while others were all calculated values.

Table 2. Primer sequences and parameter.

Genes	Gene Bank no.	Primer sequences, 5′–3′	Length, bp	Annealing temperature, °C
β-actin	NM_205518	F. GCCAACAGAGAGAAGATGACAC	118	60
		R. GTAACACCATCACCAGAGTCCA
CAT	NM_001031215.1	F. GTTGGCGGTAGGAGTCTGGTCT	182	60
		R. GTGGTCAAGGCATCTGGCTTCTG
SOD	NM_205064.1	F. TTGTCTGATGGAGATCATGGCTTC	98	60
		R. TGCTTGCCTTCAGGATTAAAGTGA
GSH-Px	NM_001163245.1	F. CAAAGTTGCGGTCAGTGGA	136	60
		R. AGAGTCCCAGGCCTTTACTACTTTC

CAT: catalase; SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; F: forward primer; R: reverse primer.

Table 3. Total phenolic and flavonoid contents and in vitro antioxidant capacities of AAE.

Items	AAE
Total phenolic, mg gallic acid equivalent/g	39.58 ± 6.01
Total flavonoid, mg rutin equivalent/g	7.04 ± 0.55
ABTS, μmol trolox equivalent/g	147.30 ± 12.34
RP, absorbance (700, nm)	2.57 ± 0.06
DPPH, %, radical scavenging activity	73.79 ± 0.79
OH, %, radical scavenging activity	27.59 ± 3.65

AAE: Artemisia annua L. aqueous extract; ABTS: 2,2′-Azino-bis (3-Ethylbenzo-Thiazoline-6Sulfonic Acid); DPPH: (2,2-diphenyl-1picrylhydrazyl). Ascorbic acid; OH: Hydroxyl radical scavenging activity; RP: reducing power.

Figure 1. Effect of AAE on average daily body weight gain (ADG) of broilers. Note: AAE = Artemisia annua L. aqueous extract; CON: control; AAE₅₀₀: 500 mg/kg AAE; AAE₁₀₀₀: 1000 mg/kg AAE; AAE₁₅₀₀: 1500 mg/kg AAE; AAE₂₀₀₀: 2000 mg/kg AAE; CTC: chlortetracycline. Results are presented as mean ± standard deviation (n = 5). ^a,b,cDifferent capital letters indicate significant differences between groups in the same period (p<.05). Dose-dependent effects of AAE are shown on the right of each figure (Lin: linear; Qua: quadratic).

Figure 2. Effect of AAE on average daily feed intake (ADFI) of broilers. Note: AAE = Artemisia annua L. aqueous extract; CON: control; AAE₅₀₀: 500 mg/kg AAE; AAE₁₀₀₀: 1000 mg/kg AAE; AAE₁₅₀₀: 1500 mg/kg AAE; AAE₂₀₀₀: 2000 mg/kg AAE; CTC: chlortetracycline. Results are presented as mean ± standard deviation (n = 5). ^a,bDifferent capital letters indicate significant differences between groups in the same period (p<.05). Dose-dependent effects of AAE are shown on the right of each figure (Lin: linear; Qua: quadratic).

Figure 3. Effect of AAE on feed conversion ratio (FCR) of broilers. Note: AAE = Artemisia annua L. aqueous extract; CON: control; AAE₅₀₀: 500 mg/kg AAE; AAE₁₀₀₀: 1000 mg/kg AAE; AAE₁₅₀₀: 1500 mg/kg AAE; AAE₂₀₀₀: 2000 mg/kg AAE; CTC: chlortetracycline. Results are presented as mean ± standard deviation (n = 5). ^a,bDifferent capital letters indicate significant differences between groups in the same period (p<.05). Dose-dependent effects of AAE are shown on the right of each figure (Lin: linear; Qua: quadratic).

Table 4. Effect of AAE on serum antioxidant capacity in broilers.

Items	CON	AAE, mg/kg				CTC, mg/kg	SEM	p Value
		500	1000	1500	2000			Anova	Linear	Quadratic
21, d
CAT, U/mL	3.26	3.30	3.76	3.66	3.65	3.97	0.25	0.470	.238	.427
SOD, U/mL	188.94^bc	172.49^c	215.90^abc	240.85^a	201.82^abc	234.21^ab	12.17	0.044	.097	.192
GSH-Px, U/mL	1628.65^c	2333.05^ab	2662.66^a	2714.16^a	1722.75^bc	2724.46^a	169.32	0.005	.827	.002
T-AOC, mM	0.50	0.61	0.60	0.61	0.63	0.46	0.05	0.308	.110	.194
MDA, nmol/mL	2.06	1.61	2.10	1.94	2.26	2.06	0.16	0.401	.399	.395
42, d
CAT, U/mL	2.74	3.21	2.97	2.12	2.48	2.77	0.25	0.481	.237	.303
SOD, U/mL	146.28^b	174.65^ab	199.35^a	185.12^ab	193.16^a	154.93^ab	11.01	0.094	.026	.018
GSH-Px, U/mL	4488.94	5423.46	5148.60	4712.85	4397.77	4122.91	478.33	0.684	.664	.497
T-AOC, mM	0.13^b	0.27^ab	0.15^b	0.37^a	0.24^ab	0.20^b	0.03	0.038	.071	.122
MDA, nmol/mL	3.02^a	1.75^b	1.98^b	1.80^b	1.91^b	1.96^b	0.19	0.029	.051	.022

^a,b,cMeans within a column that do not share a common superscript are significantly different (p< .05).

CON: control; AAE: Artemisia annua L. aqueous extract; CTC: Chlortetracycline; T-AOC: total antioxidant capacity; CAT: catalase; SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; MDA: malondialdehyde; SEM: standard error of means.

Table 5. Effect of AAE on hepatic antioxidant capacity in broilers.

Items	CON	AAE, mg/kg				CTC, mg/kg	SEM	p Value
		500	1000	1500	2000			Anova	Linear	Quadratic
21, d
CAT, U/mg prot.	15.70^b	20.21^a	20.62^a	19.98^a	18.50^ab	20.66^a	0.97	.046	.207	.007
SOD, U/mg prot.	288.24^b	400.27^ab	426.37^a	435.57^a	392.34^ab	375.67^ab	32.54	.146	.053	.010
GSH-Px, U/mg prot.	52.47^b	80.51^a	98.71^a	96.82^a	89.20^a	92.70^a	4.53	.001	.006	<.001
T-AOC, μmol/g prot.	60.43^b	81.49^ab	89.71^a	99.33^a	92.45^a	84.86^a	6.15	.054	.004	.002
MDA, nmol/mg prot.	1.63^a	1.29^ab	1.05^b	1.19^ab	1.13^ab	1.24^ab	0.12	.226	.055	.049
42, d
CAT, U/mg prot.	10.82^b	12.11^ab	16.27^a	14.20^ab	12.68^ab	12.16^ab	1.17	.177	.171	.041
SOD, U/mg prot.	674.69	704.01	797.18	813.42	7610.99	769.23	39.55	.329	.085	.096
GSH-Px, U/mg prot.	47.44	55.26	62.03	60.84	57.29	56.88	4.07	.380	.106	.078
T-AOC, μmol/g prot.	21.95^b	25.05^ab	30.68^ab	33.67^a	24.43^ab	28.77^ab	2.80	.172	.184	.062
MDA, nmol/mg prot.	1.16	1.04	0.99	0.91	0.90	0.89	0.07	.249	.012	.035

^a,bMeans within a column that do not share a common superscript are significantly different (p< .05).

CON: control; AAE: Artemisia annua L. aqueous extract; CTC: Chlortetracycline; T-AOC: total antioxidant capacity; CAT: catalase; SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; MDA: malondialdehyde; SEM: standard error of means.

Table 6. Effect of AAE on spleen antioxidant capacity in broilers.

Items	CON	AAE, mg/kg				CTC, mg/kg	SEM	p Value
		500	1000	1500	2000			Anova	Linear	Quadratic
21, d
CAT, U/mg prot.	2.01	2.47	2.47	2.20	1.92	2.43	0.29	.717	.589	.180
SOD, U/mg prot.	136.49	161.85	164.57	153.00	146.65	145.67	8.01	.282	.642	.039
GSH-Px, U/mg prot.	55.74^c	72.46^bc	90.69^ab	81.61^ab	74.69^bc	98.53^a	5.39	.004	.120	.007
T-AOC, μmol/g prot.	48.06^b	59.61^ab	68.91^a	67.08^a	58.25^ab	60.98^ab	4.23	.157	.163	.023
MDA, nmol/mg prot.	3.20^a	2.45^ab	2.06^b	2.62^ab	2.86^ab	2.18^b	0.23	.096	.697	.028
42, d
CAT, U/mg prot.	2.98	3.85	4.41	4.25	3.99	3.82	0.36	.322	.099	.045
SOD, U/mg prot.	149.51	163.01	165.67	168.50	158.22	157.17	7.18	.728	.460	.170
GSH-Px, U/mg prot.	81.87^b	97.33^ab	110.78^a	109.01^a	93.34^ab	91.02^ab	6.49	.187	.361	.045
T-AOC, μmol/g prot.	72.77^b	83.08^ab	94.59^a	96.95^a	85.74^ab	86.74^ab	3.57	.010	.011	<.001
MDA, nmol/mg prot.	6.18^a	5.41^ab	4.99^ab	4.56^b	4.18^b	4.14^b	0.38	.050	.003	.014

^a,b,cMeans within a column that do not share a common superscript are significantly different (p< .05).

CON: control; AAE: Artemisia annua L. aqueous extract; CTC: Chlortetracycline; T-AOC: total antioxidant capacity; CAT: catalase; SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; MDA: malondialdehyde; SEM: standard error of means.

Table 7. Effect of AAE on relative mRNA expression in liver of broilers.

Items	CON	AAE, mg/kg				CTC, mg/kg	SEM	p Value
		500	1000	1500	2000			Anova	Linear	Quadratic
21, d
CAT	1.00	1.05	1.24	1.23	1.13	1.11	0.08	.387	.127	.137
SOD	1.00^b	1.19^ab	1.34^a	1.38^a	1.35^a	1.14^ab	0.06	.007	.001	.001
GSH-Px	1.00^b	1.11^ab	1.20^ab	1.05^ab	1.10^ab	1.57^a	0.14	.157	.656	.710
42, d
CAT	1.00^b	1.03^ab	1.19^ab	1.29^ab	1.14^ab	1.37^a	0.10	.150	.087	.119
SOD	1.00	0.99	1.06	1.12	1.02	1.19	0.08	.648	.555	.739
GSH-Px	1.00	0.95	0.98	1.00	1.18	1.06	0.11	.797	.198	.195

^a,bMeans within a column that do not share a common superscript are significantly different (p < .05).

CON: control; AAE: Artemisia annua L. aqueous extract; CTC: chlortetracycline; CAT: catalase: SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; SEM: standard error of means.

Table 8. Effect of AAE on relative mRNA expression in spleen of broilers.

Items	CON	AAE, mg/kg				CTC, mg/kg	SEM	p Value
		500	1000	1500	2000			Anova	Linear	Quadratic
21, d
CAT	1.00	1.06	1.49	1.39	1.02	1.26	0.13	.162	.488	.033
SOD	1.00^b	1.41^ab	1.81^a	1.39^ab	1.35^ab	1.39^ab	0.18	.164	.229	.050
GSH-Px	1.00^c	1.45^bc	3.38^a	1.85^b	1.68^b	1.41^bc	0.13	<.001	.118	.002
42, d
CAT	1.00	0.93	0.97	0.93	0.92	0.93	0.04	.814	.264	.520
SOD	1.00	0.99	0.97	0.94	0.99	0.97	0.07	.997	.716	.889
GSH-Px	1.00	0.94	0.97	0.93	1.00	1.07	0.09	.956	.918	.881

^a,b,c Means within a column that do not share a common superscript are significantly different (p < .05).

CON: control; AAE: Artemisia annua L. aqueous extract; CTC: chlortetracycline; CAT: catalase; SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; SEM: standard error of means.