Growth performance, jejunum morphology and mucin-2 gene expression of broiler Japanese quails fed low-protein diets supplemented with threonine

Figures & data

Table 1. Dietary composition and nutrients.

	100% threonine requirement				110% threonine requirement
Items	CP180^b	CP200^c	CP220^d	CP240^e	CP180	CP200	CP220	CP240
Ingredients (g/kg)
Corn (850 g/kg crude protein)	658.1	603.5	551.2	498.0	656.9	602.2	550.4	496.7
SBM (440 g/kg crude protein)	260.0	311.0	354.0	395.0	260.0	311.0	354.0	395.0
Wheat bran (157 g/kg crude protein)	25.0	20.0	17.0	15.0	25.0	20.0	17.0	15.0
CGM (600 g/kg crude protein)	10.0	15.0	25.0	36.0	10.0	15.0	25.0	36.0
Soybean oil	1.0	7.5	13.0	18.5	1.4	8.0	13.0	19.0
Dicalcium phosphate	15.0	14.6	14.0	14.0	15.0	14.6	14.0	14.0
Calcium carbonate	12.7	12.7	12.6	12.6	12.7	12.7	12.6	12.6
DL-Methionine	2.5	2.0	1.5	1.0	2.5	2.0	1.5	1.0
L-lysine HCL	4.1	2.7	1.4	0.2	4.1	2.7	1.4	0.2
L-Threonine	2.2	1.6	0.9	0.26	3.0	2.4	1.7	1.1
Vitamin and mineral premix^a	5.0	5.0	5.0	5.0	5.0	5.0	5.0	5.0
Sodium chloride	2.4	2.4	2.4	2.4	2.4	2.4	2.4	2.4
Sodium bicarbonate	2.0	2.0	2.0	2.0	2.0	2.0	2.0	2.0
Calculated nutrient level (as fed basis)
ME (Kcal/kg)	2900	2900	2900	2900	2900	2900	2900	2900
Crude protein (g/kg)	180	200	220	240	180	200	220	240
Digestible lysine (g/kg)	11.2	11.2	11.2	11.2	11.2	11.2	11.2	11.2
Digestible Met + Cys (g/kg)	7.6	7.6	7.6	7.6	7.6	7.6	7.6	7.6
Digestible threonine (g/kg)	7.9	7.9	7.9	7.9	8.69	8.69	8.69	8.69
Calcium (g/kg)	9.0	9.0	9.0	9.0	9.0	9.0	9.0	9.0
Available phosphorous (g/kg)	3.75	3.75	3.75	3.75	3.75	3.75	3.75	3.75

SBM: soybean meal; CGM, Corn gluten meal; ME, Metabolisable energy.

^a Vitamin premix provided per kg of diet: vitamin A (retinol), 2.7 mg; vitamin D3 (Cholecalciferol), 0.05 mg; vitamin E (tocopheryl acetate), 18 mg; vitamin k3, 2 mg; thiamine 1.8 mg; riboflavin, 6.6 mg; panthothenic acid, 10 mg; pyridoxine, 3 mg; cyanocobalamin, 0.015 mg; niacin, 30 mg; biotin, 0.1 mg; folic acid, 1 mg; choline chloride, 250 mg; antioxidant 100 mg; Mineral premix provided per kg of diet: Fe (FeSO4.7H2O, 20.09% Fe), 50 mg; Mn (MnSO4.H2O,32.49% Mn), 100 mg; Zn (ZnO, 80.35% Zn), 100 mg; Cu (CuSO4.5H2O), 10 mg; I (KI, 58% I), 1 mg; Se (NaSeO3, 45.56% Se), 0.2 mg.

^b CP180: a diet with 180 g/kg crude protein content.

^c CP200: a diet with 200 g/kg crude protein content.

^d CP220: a diet with 220 g/kg crude protein content.

^e CP240: a diet with 240 g/kg crude protein content.

Table 2. Primers used for quantitative real-time PCR.

Target gene	Gene bank accession	Forward sequence (5′ to 3′)	Reverse sequence (5′ to 3′)
Mucin-2	NM_001318434	CCACAAGTCCTCCAGTACCTACA	AGGTTTCATAGTCACCACCATCTTC
ß-actin	NM_205518	CTGGCACCTAGCACAATGAA	CTGGTTGCTGATCCACATCT

Table 3. Effects of dietary treatments on growth performance of broiler quails.

	Threonine level (%)	Daily feed intake, g/day	Daily weight gain, g/day	Feed conversion ratio, g:g
CP level (g/kg)		1-35 d	1-35 d	1-35 d
180	100	21.64	6.91	3.36
180	110	21.37	6.84	3.13
200	100	20.84	7.26	2.87
200	110	22.96	6.93	3.33
220	100	22.57	7.35	3.12
220	110	21.64	7.16	3.02
240	100	23.31	7.33	3.17
240	110	21.99	7.49	3.02
SEM
CP level (g/kg)
180		21.51	6.87^c	3.25
200		21.90	7.10^b	3.10
220		22.11	7.26^ab	3.07
240		22.65	7.41^a	3.10
SEM
Threonine level (%)
100		22.10	7.21	3.13
110		21.99	7.11	3.12
SEM
p Value
CP level		0.591	0.031	0.582
Threonine level		0.865	0.175	0.942
CP level × Threonine level		0.183	0.162	0.070

CP: Crude protein.

^a,b,cValues in the same column not sharing a common superscript differ significantly (p < .05).

Table 4. Effects of dietary treatments on carcase traits of broiler quails on day 35 of age.

	Threonine level (%)	Relative weight, % BW
CP level (g/kg)		Carcase	Gizzard	Duodenum	Jejunum	Ileum	Caecum
180	100	67.96^c	2.09	0.53	0.67	0.52	1.02
180	110	66.45^c	2.00	0.48	0.66	0.55	1.03
200	100	69.54^c	2.42	0.57	0.79	0.70	1.13
200	110	79.85^a	2.35	0.64	0.85	0.64	1.08
220	100	69.74^c	2.23	0.62	0.80	0.65	1.10
220	110	70.51^bc	2.12	0.60	0.75	0.58	1.07
240	100	75.76^ab	2.52	0.65	0.92	0.70	1.10
240	110	75.23^ab	2.28	0.64	0.82	0.68	1.32
SEM
CP level (g/kg)
180		67.21^b	2.05^b	0.51^b	0.67	0.53	1.03
200		70.08^b	2.19^ab	0.60^a	0.82	0.66	1.11
220		74.18^a	2.38^a	0.61^a	0.78	0.61	1.08
240		75.49^a	2.39^a	0.65^a	0.87	0.69	1.21
SEM
Threonine level (%)
100		70.71	2.30	0.59	0.80	0.64	1.08
110		72.69	2.18	0.58	0.76	0.61	1.13
SEM
P-value
CP level		<.0001	0.006	<.0001	0.251	0.582	0.14
Threonine level		0.091	0.135	0.952	0.492	0.322	0.062
CP level × Threonine level		0.009	0.891	0.275	0.523	0.713	0.374

CP: Crude protein; BW: body weight.

^a,b,cValues in the same column not sharing a common superscript differ significantly (p < .05).

Table 5. Effects of dietary treatments on morphology of jejunum in broiler quails.

	Threonine level (%)	Jejunum, μm
CP level (g/kg)		Villus height	Crypt depth	V/C	Goblet cell count
180	100	531.25^b	55.62^bc	10.09^bc	8.76^b
180	110	648.57^a	60.00^abc	10.81^ab	10.96^a
200	100	707.50^a	60.00^abc	12.14^a	8.76^b
200	110	495.00^b	51.25^cd	9.70^bc	10.96^a
220	100	650.00^a	63.75^ab	9.44^bc	6.60^c
220	110	646.87^a	67.50^a	8.73^c	11.29^a
240	100	486.25^b	56.25^bc	8.72^c	12.22^a
240	110	531.25^b	43.75^d	12.05^a	6.05^c
SEM
CP level (g/kg)
180		590.00^b	57.81^b	10.45^a	6.76^b
200		601.25^b	55.62^bc	10.92^a	8.94^a
220		648.43^a	65.62^a	9.08^b	9.86^a
240		508.75^c	50.00^c	10.38^ab	9.14^a
SEM
Threonine level (%)
100		593.75	58.90	10.09	8.59
110		580.46	57.81	10.32	8.76
SEM
p Value
CP level		<.0001	<.0001	0.04	<.0001
Threonine level		0.39	0.17	0.62	0.67
CP level × Threonine level		<.0001	0.02	<.0001	<.0001

CP: crude protein; V/C: villus height to crypt depth ratio.

^a,b,c,dValues in the same column not sharing a common superscript differ significantly (p < .05).

Table 6. Effects of dietary treatments on ileal protein digestibility.

CP level (g/kg)	Threonine level (%)	CP digestibility
180	100	82.71
180	110	81.98
200	100	82.49
200	110	82.57
220	100	82.52
220	110	82.73
240	100	82.37
240	110	82.64
SEM
CP level (g/kg)
180		82.34
200		82.53
220		82.63
240		82.51
SEM
Threonine level (%)
100		82.53
110		82.48
SEM
p Value
CP level		0.51
Threonine level		0.45
CP level × threonine level		0.12

CP: crude protein.

^a,b,cValues in the same column not sharing a common superscript differ significantly (p < .05).

Table 7. Effects of dietary treatments on mRNA expression of mucin-2 gene.

CP level (g/kg)	Threonine level (%)	Mucin-2 expression
180	100	4.34
180	110	4.40
200	100	3.29
200	110	4.10
220	100	2.39
220	110	3.19
240	100	2.04
240	110	2.30
SEM
CP level (g/kg)
180		4.37^a
200		3.70^b
220		2.79^c
240		2.17^d
SEM
Threonine level (%)
100		3.03^b
110		3.48^a
SEM
p Value
CP level		<.0001
Threonine level		0.20
CP level × Threonine level		0.82

CP: crude protein.

^a,b,c,dValues in the same column not sharing a common superscript differ significantly (p < .05).