Sodium butyrate improved intestinal barrier in rabbits

Figures & data

Table 1. Composition and nutrient levels of basal diets (air-dry basis).

Item	Content	Item	Content
Ingredients		Nutrient levels^b
Corn	14%	DE, MJ/kg	13.10%
Wheat middlings	4%	DM	91.59%
Wheat bran	13%	CP	16.78%
Bean straw powder	9%	Ash	7.44%
Alkali grass powder	7%	EE	3.27%
Peanut shell	4%	CF	13.90%
Soybean meal	8%	Ca	1.48%
Black beer lees	12%	P	0.69%
Germ meal	8%
Peanult seedling powder	7%
Rich husk powder	9%
Premix^a	5%
Total	100%

^aThe premix provided the following per kg of diets: Va 10,000 U, VD3 2000 U, VE 60 mg,VK3 2 mg, VB1 5 mg, VB2 10 mg, choline chloride 500 mg, Fe (as ferrous sulfate) 100 mg, Zn (as Zinc) 50 mg, Se (as Selenium) 0.05 mg, I (as Iodine) 0.6 mg, Lys 1500 mg, Met 1500 mg. The rest was miscellaneousmeal carrier complement.

^bNutrient levels were measured values.

DE: digestible energy; DM: dry matter; CP: crude protein; EE: ether extract; CF: crude fibre; Ca: calcium; P: phosphorus.

Table 2. Gene-specific primers used for the analysis of rabbit gene expression.

Gene	Genebank accession number	Primers sequences (5′→3′)	Product size, bp
β-actin	NM_001101683.1	F:CGCAGAAACGAGACGAGATT	168
		R:GCAGAACTTTGGGGACTTTG
Muc 1^1	L41544.1	F: TATACCGCAAGCAGCCAGGT	135
		R: GCAAGCAGGACACAGACCAG
Occludin	XM_008262318	F: CTTGCCTGGGACAGAACCTA	121
		R: AGCCATAACCGTAGCCGTAA

Muc 1: Mucorprotein 1.

Table 3. Effect of Sodium butyrate on production performance of meat rabbit (n = 40).

Item	Sodium butyrate	Antibiotic	Control	SEM	p Value
Death rate (%)	10.50	13.00	18.50	–	–
Diarrhoea rate (%)	10.00	10.50	20.50	–	–
ADFI (g/d)	145.77	140.50	143.22	16.400	.3599
ADG (g/d)	41.04	40.73	39.20	3.994	.0925
F/G	3.56	3.46	3.66	0.380	.0729

ADFI: average daily feed intake; ADG: average daily gain; F/G: ADFI/ADG.

Table 4. Effect of sodium butyrate on intestinal morphology of meat rabbits (n = 8).

Item	Sodium butyrate	Antibiotic	Control	SEM	p Value
Jejunum
Villus height, µm	682.13	666.00	645.31	67.890	.5627
Crypt depth, µm	138.50^a	151.19^b	166.44^b	19.502	.0310
V/C	4.96^a	4.44^b	3.92^b	0.5876	.0079
Ileum
Villus height, µm	647.60^a	660.80^a	593.40^b	33.105	.0171
Crypt depth, µm	129.03	151.20	159.61	20.817	.0949
V/C	5.02^a	4.47^a	3.78^b	0.551	.0130
Duodenum
Villus height, µm	646.75	636.25	595.25	40.904	.2247
Crypt depth, µm	163.75	165.50	171.25	4.6963	.1139
V/C	3.95^a	3.84^a	3.47^b	0.2381	.0476

Means within lines with different superscript letters are significantly different (p < .05).

V/C: Villus height/Crypt depth.

Figure 1. Intestinal microflora clustering map.

Figure 2. Display of intestinal flora at phylum level.

Figure 3. Display of intestinal flora at genus level.

Figure 4. Prediction of potentially pathogenic bacteria.

Figure 5. Effect of Sodium butyrate on the contents of IL-4, IFN- γ and SIgA. The same letter means that there is no significant difference (p>.05), while different letters indicate that there is a significant difference (p<.05). IL-4: interleukin-4; IFN-γ: interferon-γ; SIgA: secretory immunoglobulin A.

Figure 6. Intestinal related gene expression. The same letter means that there is no significant difference (p>.05), while different letters indicate that there is a significant difference (p<.05).