Betaine could help ameliorate transport associated water deprivation stress in broilers by reducing the expression of stress-related transcripts and modulating water channel activity

Figures & data

Table 1. Feed ingredients and calculated composition of the diets.

Ingredient (%) (as fed basis)	Starter (0–21 days)	Finisher (21–32 days)
Yellow corn	56.32	60.36
Soybean meal (48%)	37.60	32.32
Vegetable oil	2.28	3.96
Dicalcium phosphate	1.62	1.38
Limestone	1.02	0.92
Dl-Methionine	0.31	0.28
L-Lysine HCL	0.15	0.12
L-Threonine	0.09	0.06
Common salt	0.40	0.40
Vitamin premix^a	0.10	0.10
Mineral premix^b	0.10	0.10
Calculated Composition	100.00	100.00
Metabolizable energy, kcal/kg	3050	3200
Crude protein, %	22.25	20.00
Calcium, %	0.92	0.81
Available phosphorus, %	0.46	0.41
Digestible lysine, %	1.22	1.06
Digestible methionine, %	0.62	0.56
Digestible total sulphur AA, %	0.91	0.83
Digestible threonine, %	0.81	0.71

^a Vitamin premix provided the following (per kg of diet): Vitamin B₁, 2 mg; Niacin, 50 mg; Vitamin B₂, 6 mg; Pantothenic Acid, 15 mg; Vitamin B₁₂, 16.0 μg; Vitamin B₆, 3 mg; Biotin, 150 μg; Folic Acid, 1.75 mg; Vitamin K₃ (MNB), 3 mg; Vitamin D₃ (cholecalciferol), 5000 U; Vitamin A (retinol acetate), 10,000 U; Vitamin E (Dl-alpha-tocopheryl acetate), 50 U; Total antioxidants, 50 mg.

^b Trace mineral premix provides the following in milligrams per kilogram of diet: Manganese (Oxide), 120; Zinc (Oxide), 100; Iron (Sulphate), 40; Copper (Sulphate), 16; Iodine (Potassium Iodide), 1.25; Selenium (Sodium Selenite) 0.30.

Table 2. The primers sequence and information used for real-time PCR analysis.

Gene name	Sequence 5′–3′	Size, bp	Accession No.
GR-F	TATGACAGCACGCTGCCCGA	76	NM_001037826
GR-R	CTACCACTTGCCGTCCTCCTAACAT
ACTB-F	CCATCTATGAAGGCTACGC	124	NM_205518
ACTB-R	CTCGGCTGTGGTGGTGAA
POMC-F	GGAAAAGAAGGATGGAGGCTC	155	NM_001031098
POMC-R	TCTTGTAGGCGCTTTTGACGAT
AQP1-F	AGCTGGTTTTGTGCGTTCTT	143	NM_001039453.1
AQP1-R	TCTGGCTGGGTTAATTCCAC
AQP3-F	TGCTCCTGGTCCCTGACACT	58	AB358970.1
AQP3-R	CTTTTGCCTTCCCATTGCA
AQP4-F	CGCTCGCAGCAGCAGTAA	59	NM_001317827
AQP4-R	ATGCTACCATGATGCTCTCACACT
AQP9-F	CACAATTCCTGGGAGCATTT	110	AB359226.1
AQP9-R	TGTTGCGTAAGGTCCTGTGA

Note. F: forward primer; R: reverse primer; bp: base pair; ACTB: beta actin; GR: glucocorticoids receptor; POMC: proopiomelanocortin; AQP: aquaporin.

Table 3. Effect of betaine supplementation on broiler performance at 32 days of age.

Variable	Betaine supplementation^1^,2,3				p-Value	SEM
	0.2% in feed	None	1 mL in water	2 mL in water
Feed intake (g/bird)	1555.3^a	1616.4^b	1637.1^b	1623.3^b	.004	16.0
Weight gain (g/bird)	1119.1	1103.3	1114.4	1093.0	.561	14.0
FCR (g/g)	1.39^a	1.47^b	1.47^b	1.49^b	.001	0.02

¹ Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented.

² Values are means of 14 replicate pens per treatment.

³ Means within a row with no common superscript differ significantly (p ≤ .05).

FCR: Feed Conversion Ratio.

Table 4. Effect of betaine supplementation and pre-slaughter transport on broiler processing performance at 32 days of age.

	Betaine^1	n^2	Live BW, g	Eviscerated carcass^3, %	Wings^4, %	Pectoralis major^4, %	Pectoralis minor^4, %	Saddles^4,5, %
Transport distance
Short	0.2% in feed	7	1998	72.67	9.59	29.66	5.56	39.43
	None	7	1945	72.53	9.77	28.74	5.55	40.22
	1 mL in water	7	2014	72.68	9.99	29.80	5.65	39.22
	2 mL in water	7	1936	72.26	9.99	28.62	5.70	40.01
Long	0.2% in feed	7	1962	72.13	9.85	28.93	5.67	39.52
	None	7	1859	72.03	9.78	29.83	5.72	39.04
	1 mL in water	7	1849	72.98	9.97	29.38	5.68	39.69
	2 mL in water	7	1998	72.82	9.82	29.43	5.62	39.38
	SEM		48.00	0.39	0.16	0.50	0.13	0.47
Main effect means
Short		28	1973	72.54	9.84	29.21	5.62	39.72
Long		28	1917	72.49	9.86	29.39	5.68	39.41
SEM			24	0.19	0.08	0.25	0.07	0.24
	0.2% in feed	14	1980	72.40	9.72	29.30	5.62	39.48
	None	14	1901	72.28	9.77	29.28	5.64	39.63
	1 mL in water	14	1931	72.83	9.98	29.51	5.68	39.45
	2 mL in water	14	1967	72.54	9.91	29.03	5.66	39.69
	SEM		34.00	0.28	0.11	0.36	0.09	0.33
Source of variation			p-Values
Transport			.103	.876	.865	.610	.531	.359
Betaine			.353	.534	.328	.742	.980	.947
Transport × betaine			.126	.390	.601	.204	.792	.313

¹ Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented. Half of the pens were then cooped and transported for 4 h pre-slaughter whereas the other half were transported for a very short distance to the slaughter house for processing.

² Number of replicate pens with 2 broiler chickens selected from each pen for processing.

³ Calculated as a percentage of live BW.

⁴Calculated as a percentage of chilled eviscerated carcase.

⁵Legs and backs combined.

BW: Body Weight.

Table 5. Effect of betaine supplementation and pre-slaughter transport on meat quality of broiler chickens at 32 days of age.

	Betaine^1	n^2	Post-mortem pH		Post-mortem temp.		Initial colour components^3			Ultimate colour components^3
			0 h	24 h	0 h	24 h	Li*	ai*	bi*	Lu*	au*	bu*
Transport distance
Short	0.2% in feed	7	6.39	6.09	26.96	14.87	47.50	3.77	3.57	50.19	5.34	6.46
	None	7	6.30	6.09	26.87	15.04	46.64	4.07	3.69	48.87	6.64	7.43
	1 mL in water	7	6.31	6.10	27.06	15.70	47.37	4.66	3.59	49.79	6.50	6.90
	2 mL in water	7	6.36	6.07	26.96	14.71	46.50	4.43	3.67	48.99	6.09	7.44
Long	0.2% in feed	7	6.31	6.16	28.99	13.17	46.56	4.26	3.07	51.00	6.04	6.36
	None	7	6.31	6.16	29.43	13.49	47.01	4.03	3.99	50.16	5.69	6.30
	1 mL in water	7	6.24	6.11	28.87	13.03	46.03	4.23	3.34	49.34	6.23	6.56
	2 mL in water	7	6.27	6.17	29.33	12.41	45.76	3.89	3.01	50.20	5.44	5.90
	SEM		0.04	0.04	0.58	0.72	0.74	0.32	0.38	1.00	0.47	0.57
Main effect means
Short		28	6.34^a	6.09^b	26.96^b	15.08^a	47.00	4.23	3.63	49.46	6.14	7.06
Long		28	6.29^b	6.15^a	29.15^a	13.03^b	46.33	4.10	3.35	50.18	5.85	6.28
SEM			0.02	0.02	0.29	0.36	0.37	0.16	0.19	0.50	0.24	0.28
	0.2% in feed	14	6.35	6.12	27.97	14.02	47.03	4.01	3.32	50.56	5.69	6.41
	None	14	6.31	6.12	28.15	14.26	46.83	4.05	3.83	49.51	6.16	6.86
	1 mL in water	14	6.28	6.11	27.96	14.36	46.70	4.44	3.46	49.56	6.36	6.73
	2 mL in water	14	6.31	6.12	28.14	13.56	46.13	4.16	3.34	49.59	5.76	6.67
	SEM		0.03	0.03	0.41	0.51	0.52	0.23	0.27	0.70	0.33	0.40
Source of variation			p-Values
Transport			.047	.019	<.001	<.001	.211	.560	.317	.313	.385	.059
Betaine			.301	.974	.979	.694	.655	.531	.517	.655	.436	.877
Transport × Betaine			.523	.709	.920	.855	.690	.374	.621	.808	.336	.557

¹ Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented. Half of the pens were then cooped and transported for 4 h pre-slaughter whereas the other half were transported for a very short distance to the slaughter house for processing.

² Number of replicate pens with 2 broiler chickens selected from each pen for processing.

³ L*: lightness; a*: redness; b*: yellowness.

Means within a column with no common superscript differ significantly (P ≤ 0.05).

Table 6. Effect of betaine supplementation and pre-slaughter transport on meat quality of broiler chickens at 32 days of age.

	Betaine^1	n^2	WHC^3, %	Cooking loss, %	MFI^4	Shear force, N	Texture profile analysis
							Hardness, N	Springiness^5	Cohesiveness^5	Chewiness, N
Transport distance
Short	0.2% in feed	7	25.33	27.41	90.46	6.36	7.00	0.71	0.40	2.23
	None	7	24.57	26.37	91.90	6.21	7.69	0.76	0.43	2.50
	1 mL in water	7	24.20	31.73	92.00	5.97	6.83	0.74	0.40	2.21
	2 mL in water	7	23.10	24.17	102.83	6.11	7.19	0.70	0.41	2.26
Long	0.2% in feed	7	22.64	27.70	95.39	6.76	6.77	0.70	0.41	2.06
	None	7	22.16	28.67	100.33	6.41	6.57	0.71	0.40	1.99
	1 mL in water	7	21.57	28.94	100.23	5.87	6.70	0.73	0.43	2.19
	2 mL in water	7	21.53	28.06	94.41	6.86	9.17	0.70	0.41	2.90
	SEM		1.20	2.86	5.63	0.33	0.67	0.02	0.02	0.27
Main effect means
Short		28	24.30^a	27.42	94.30	6.16	7.18	0.73	0.41	2.30
Long		28	21.98^b	28.34	97.59	6.48	7.30	0.71	0.41	2.28
SEM			0.60	1.43	2.82	0.17	0.34	0.01	0.01	0.13
	0.2% in feed	14	23.99	27.56	92.92	6.56	6.89	0.71	0.41	2.14
	None	14	23.36	27.52	96.11	6.31	7.13	0.74	0.41	2.24
	1 mL in water	14	22.89	30.34	96.11	5.92	6.76	0.74	0.41	2.20
	2 mL in water	14	22.31	26.11	98.62	6.49	8.18	0.70	0.41	2.58
	SEM		0.85	2.03	3.98	0.24	0.48	0.01	0.01	0.19
Source of variation			p-Values
Transport			.008	.651	.412	.195	.788	.231	.785	.925
Betaine			.554	.521	.793	.241	.154	.195	.973	.365
Transport × Betaine			.964	.681	.400	.644	.141	.773	.461	.188

¹Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented. Half of the pens were then cooped and transported for 4 h pre-slaughter whereas the other half were transported for a very short distance to the slaughter house for processing.

²Number of replicate pens with 2 chickens selected from each pen for processing.

³Water holding capacity.

⁴Myofibril fragmentation index.

⁵Unitless.

Means within a column with no common superscript differ significantly (P ≤ 0.05).

Table 7. Effect of betaine supplementation and pre-slaughter transport on blood biochemical indices of broilers at 32 days of age.

	Betaine^1	n^2	Albumin, g/dL	Uric acid, mg/dL	Glucose, mg/dL	Triglycerides, mg/dL	ALT^3, U/L	AST^3, U/L
Transport distance
Short	0.2% in feed	7	1.49	1.9	178.18	118	9	271
	None	7	1.56	1.8	173.83	119	8	251
	1 mL in water	7	1.54	1.9	193.80	115	8	264
	2 mL in water	7	1.58	1.9	185.89	120	8	238
Long	0.2% in feed	7	1.54	1.9	212.24	115	8	264
	None	7	1.48	1.9	202.41	121	8	268
	1 mL in water	7	1.48	1.9	208.34	116	8	256
	2 mL in water	7	1.51	2.3	213.95	117	7	256
	SEM		0.04	0.1	6.03	7	0.7	12
Main effect means
Short		28	1.55	1.9	182.93^b	118	8	256
Long		28	1.50	2.0	209.24^a	117	8	261
SEM			0.02	0.1	3.01	3	0.4	6
	0.2% in feed	14	1.52	1.9	195.21	116	8	268
	None	14	1.52	1.9	188.12	120	8	259
	1 mL in water	14	1.51	1.9	201.07	115	8	260
	2 mL in water	14	1.55	2.1	199.92	118	8	247
	SEM		0.03	0.1	4.26	5	0.5	8
Source of variation			p-Values
Transport			.118	.166	<.001	.895	.379	.515
Betaine			.829	.267	.141	.896	.843	.388
Transport × Betaine			.301	.100	.424	.966	.605	.543

¹ Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented. Half of the pens were then cooped and transported for 4 h pre-slaughter whereas the other half were transported for a very short distance to the slaughter house for processing.

² Number of replicate pens with 2 broiler chickens selected randomly from each pen for blood sampling.

³ ALT: alanine aminotransferase; AST: aspartate aminotransferase.Means within a column with no common superscript differ significantly (P ≤ 0.05).

Table 8. Effect of betaine supplementation and pre-slaughter transport on gene expression of broiler chickens at 32 days of age.

	Betaine^1	n^2	Brain^3			Muscle^3			Liver^3			Intestine^3
			POMC	AQP1	AQP4	GR	AQP1	AQP9	GR	AQP3	AQP9	AQP3
Distance
Short	0.2% in feed	5	1.00^e	1.00^bc	1.00^ab	1.00^bc	1.00	1.00	1.00	1.00^bc	1.00^a	1.00^b
	None	5	0.73^c	0.66^c	0.89^b	0.43^b	0.92	1.04	0.72	0.89^a	0.53^b	0.51^bc
	1 mL in water	5	2.25^e	0.61^a	0.82^b	1.11 ^cd	1.11	1.33	0.86	1.34^bc	0.43^a	0.64^a
	2 mL in water	5	2.68^b	0.79^ab	1.11^ab	1.62^d	1.07	1.30	0.96	1.21^e	0.41^a	0.87^a
Long	0.2% in feed	5	0.98^e	1.46^c	0.82^ab	0.68^d	1.07	1.21	0.44	0.97 ^cd	0.86^b	1.98^bc
	None	5	4.54^b	1.26^bc	1.23^ab	0.63^a	0.97	1.16	0.11	0.33^ab	1.02^b	0.39^bc
	1 mL in water	5	2.71^a	1.22^ab	1.19^a	0.51 ^cd	1.10	1.19	0.21	0.52^e	0.98^a	2.28^c
	2 mL in water	5	1.60^d	1.02^bc	1.12^ab	0.70 ^cd	1.12	1.74	0.33	0.62^de	0.53^b	2.26^a
	SEM		0.09	0.09	0.09	0.08	0.07	0.10	0.07	0.07	0.05	0.11
Main effect means
Short		20	1.67	0.81	0.96	1.04	1.02	1.17^b	0.88^a	1.11	0.59	0.76
Long		20	2.46	1.24	1.09	0.63	1.06	1.32^a	0.28^b	0.61	0.85	1.73
SEM			0.04	0.05	0.04	0.04	0.03	0.05	0.04	0.03	0.02	0.05
	0.2% in feed	10	0.99	1.23	0.91	0.84	1.03	1.11^b	0.72^a	0.98	0.93	1.49
	None	10	2.64	0.96	1.06	0.53	0.94	1.10^b	0.42^c	0.61	0.77	0.45
	1 mL in water	10	2.48	0.92	1.01	0.81	1.10	1.26^ab	0.54^ac	0.93	0.70	1.46
	2 mL in water	10	2.14	1.00	1.11	1.16	1.09	1.52^a	0.64^a	0.91	0.47	1.57
	SEM		0.06	0.07	0.06	0.06	0.05	0.07	0.05	0.05	0.03	0.08
Source of variation			p-Values
Distance			<.001	<.001	.034	<.001	.399	.04	<.001	<.001	<.001	<.001
Betaine			<.001	.011	.122	<.001	.093	<.001	<.001	<.001	<.001	<.001
Distance × Betaine			<.001	.018	.007	<.001	.963	.054	.926	<.001	<.001	<.001

¹ Treatment groups were supplemented with betaine at 0.2% of finisher feed, 1 mL/L of drinking water 72 h pre-slaughter, 2 mL/L of drinking water 72 h pre-slaughter or non-supplemented. Half of the pens were then cooped and transported for 4 h pre-slaughter whereas the other half were transported for a very short distance to the slaughter house for processing.

² Number of replicate pens with 2 broiler chickens selected randomly from each pen for blood sampling.

³ Proopiomelanocortin (POMC), glucocorticoid receptor (GR), aquaporin (AQP).

Means within a column with no common superscript differ significantly (P ≤ 0.05).

Aberle ED, Forrest JC, Gerrard DE, Mills EW. 2001. Principles of meat science. 4th ed. Dubuque (IA): Kendall Hunt. p. 109–116.

 Google Scholar

Al-Owaimer AN, Suliman GM, Alyemni AH, Abudabos AM. 2014. Effect of different probiotics on breast quality characteristics of broilers under Salmonella challenge. Italian J Anim Sci. 13:450–454.

 Web of Science ®Google Scholar

Chen R, Zhuang S, Chen YP, Cheng YF, Wen C, Zhou YM. 2018. Betaine improves the growth performance and muscle growth of partridge shank broiler chickens via altering myogenic gene expression and insulin-like growth factor-1 signaling pathway. Poult Sci. 97(12):4297–4305.

 PubMed Web of Science ®Google Scholar

Esteve-Garcia E, Mack S. 2000. The effect of DL-methionine and betaine on growth performance and carcass characteristics in broilers. Anim Feed Sci Technol. 87(1–2):85–93.

 Web of Science ®Google Scholar