Combination of Lactobacillus species and yeast ameliorates adverse effect of deoxynivalenol contaminated diet on immune system, gut morphology and jejunal gene expression in broiler chickens

Figures & data

Table 1. Composition of the basal experimental diets (as-fed basis).

Ingredients, %	Starter (1–10d)	Grower (11–22d)	Finisher (23–35d)
Maize	51.32	58.94	60.31
Soybean Meal	39.15	32.28	29.82
Rice	2.86	2.86	2.86
Soybean oil	1.20	0.80	2.10
Dicalcium phosphate	2.50	2.30	1.91
CaCO3	0.90	0.87	1.10
Common Salt	0.30	0.30	0.27
Vitamin Premix^a	0.25	0.25	0.25
Mineral Premix^b	0.25	0.25	0.25
DL-Methionine	0.43	0.39	0.39
L-Lysine HCL	0.35	0.38	0.38
NaHCO3	0.28	0.18	0.15
L-Threonine	0.21	0.20	0.21
Calculated composition
ME, Mcal/kg	2.90	2.95	3.05
Protein, %	22.50	20.00	19.00
Calcium, %	0.99	0.92	0.90
Available Phosphorus, %	0.48	0.44	0.38
Lysine, %	1.36	1.23	1.17
Met + Cys, %	1.02	0.93	0.91

^a Each Kg of vitamin supplement contains: Vitamin A, 3600000 IU; vitamin D3, 800000 IU; vitamin E, 7200 IU; vitamin K3, 800 mg; vitamin B1, 720 mg; vitamin B2, 2640 mg; vitamin B3, 4000 mg; vitamin B5, 12000 mg; vitamin B6, 1200 mg; vitamin B9, 400 mg; vitamin B12, 6 mg; biotin, 40 mg; choline chloride, 100000 mg; antioxidant, 40000 mg.

^b Each Kg of mineral supplement contains: Mn, 40000 mg; Zn, 33880 mg; Fe, 20000 mg; Cu, 4000 mg; I, 400 mg; Se, 80 mg; choline chloride, 100000 mg.

ME: Metabolizable energy.

Table 2. Gene sequence for Real-Time PCR.

Gene^a	Primer sequence		Accession number	Product size (pb)
	Forward	Reverse
GAPDH	GGTGGTGCTAAGCGTGTTAT	ACCTCTGTCATCTCTCCACA	K01458	264
TLR-4	CTGACCTACCCATCGGACAC	GCCTGAGAGAGGTCAGGTTG	NM-001030693	111
MUC-2	CAACTCCTCCTTTGTATGCGTG	GACGTTGATCTCATAGTTATGGCAG	NM-001318434.1	187
CLDN-5	CATCACTTCTCCTTCGTCAGC	GCACAAAGATCTCCCAGGTC	NM-204201	111

^a GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; MUC-2: Mucin-2; TLR-4: Toll like receptor; CLDN-5: Claudin-5.

Table 3. Effect of Lactobacillus sp. and yeast in DON diets on performance attributes of broiler chicken from 1 to 35 days of age.

	Overall (1–35d)
Lactobacillus sp. (g/kg) ADG(g)	AFI(g)	FCR(g/g)
0	47.57	82.15	1.73
0.20	47.88	81.78	1.71
0.40	46.94	81.23	1.73
SEM	0.65	0.97	0.02
Yeast (g/kg)
0	47.34	82.14	1.74
0.75	47.42	81.69	1.73
1.50	47.63	81.34	1.71
SEM	0.65	0.97	0.02
Lactobacillus sp.× yeast
0 × 0	47.09	81.41	1.74
0 × 0.75	47.99	81.48	1.70
0 × 1.50	47.65	83.58	1.76
0.20 × 0	48.46	82.88	1.71
0.20 × 0.75	47.08	82.65	1.76
0.20 × 1.50	48.09	79.83	1.66
0.40 × 0	46.48	82.14	1.77
0.40 × 0.75	47.19	80.95	1.72
0.40 × 1.50	47.14	80.60	1.71
SEM	1.13	1.67	0.04
p-Value
Lactobacillus sp.	0.588	0.795	0.524
Yeast	0.952	0.841	0.382
Lactobacillus sp. × yeast	0.865	0.527	0.414
Orthogonal Polynomials contrasts
Linear Lactobacillus sp.	0.496	0.506	0.962
Quadratic Lactobacillus sp.	0.443	0.937	0.492
Linear Yeast	0.763	0.560	0.406
Quadratic Yeast	0.935	0.560	0.923

SEM: Standard error means.

Table 4. Effect of treatments on the relative weight (% organ weight to body weight) of immune system organ and serum antibody titres against Newcastle disease virus (NDV; log₂) in broiler chickens.

Lactobacillus sp. (g/kg)	Spleen	Fabricius bursa	NDV titre
0	0.12^ab	0.21	4.38^b
0.20	0.11^b	0.21	5.58^a
0.40	0.13^a	0.22	5.83^a
SEM	0.01	0.008	0.25
Yeast (g/kg)
0	0.11	0.21^ab	5.04^ab
0.75	0.12	0.20^b	4.88^b
1.50	0.12	0.23^a	5.88^a
SEM	0.01	0.008	0.25
Lactobacillus ×Yeast
0 × 0	0.11^bc	0.21	4.25
0 × 0.75	0.14^ab	0.21	4.13
0 × 1.50	0.10^c	0.21	4.75
0.20 × 0	0.11^bc	0.21	5.38
0.20 × 0.75	0.12^abc	0.18	5.38
0.20 × 1.50	0.10^bc	0.24	6.00
0.40 × 0	0.12^abc	0.22	5.50
0.40 × 0.75	0.11^bc	0.21	5.13
0.40 × 1.50	0.16^a	0.25	6.88
SEM	0.03	0.01	0.43
P-Value
Lactobacillus sp.	0.018	0.415	0.0002
Yeast	0.593	0.018	0.012
Lactobacillus ×Yeast	0.0005	0.332	0.645
Orthogonal polynomials contrasts
Linear Lactobacillus sp.	0.051	0.252	<0.0001
Quadratic Lactobacillus sp.	0.035	0.507	0.117
Linear yeast	0.691	0.105	0.020
Quadratic yeast	0.348	0.019	0.057

^a–cMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means.

Table 5. Effects of Lactobacillus sp. and yeast in deoxynivalenol contaminated diets on hematological parameters in broiler chickens.

Lactobacillus sp. (g/kg)	Haematocrit (%)	Haemoglobin (g/dl)	RBCs (×10^6/ µl)	WBCs (×10^4/ µl)	Lymphocyte (%)	Heterophil (%)	H/L ratio
0	30.83	10.89	3.25	1.91^a	70.79^ab	26.50^ab	0.39^ab
0.20	29.13	10.28	3.08	1.65^b	69.92^b	27.54^a	0.40^a
0.40	30.44	10.72	3.05	1.92^a	74.667^a	24.13^b	0.33^b
SEM	0.52	0.20	0.09	0.08	1.25	1.03	0.02
Yeast (g/kg)
0	30.35^ab	10.66	3.26	1.69^b	72.00	25.75	0.37
0.75	28.67^b	10.34	3.08	1.72^b	70.50	27.08	0.39
1.50	31.36^a	10.89	3.04	2.06^a	72.88	25.33	0.36
SEM	0.52	0.20	0.09	0.08	1.25	1.03	0.02
Lactobacillus ×Yeast
0 × 0	32.08	11.33	3.46	1.55^c	68.88^b	27.63^ab	0.41^ab
0 × 0.75	28.34	10.35	3.00	1.94^abc	73.00^ab	24.75^ab	0.35^ab
0 × 1.50	32.06	11.00	3.30	2.25^ab	70.50^ab	27.13^ab	0.40^ab
0.20 × 0	29.38	10.40	3.15	1.88^abc	72.00^ab	26.38^ab	0.38^ab
0.20 × 0.75	28.50	10.26	3.05	1.55^c	68.75^b	27.88^ab	0.42^ab
0.20 × 1.50	29.50	10.16	3.04	1.51^c	69.00^b	28.38^a	0.41^a
0.40 × 0	29.61	10.26	3.16	1.65^bc	75.13^ab	23.25^ab	0.32^ab
0.40 × 0.75	29.18	10.40	3.20	1.68^bc	69.75^ab	28.63^a	0.41^a
0.40 × 1.50	32.53	11.50	2.78	2.44^a	79.13^a	20.50^b	0.26^b
SEM	0.91	0.35	0.16	0.14	2.16	1.78	0.038
P-Value
Probiotic	0.062	0.095	0.233	0.024	0.021	0.051	0.033
Yeast	0.002	0.167	0.207	0.004	0.402	0.425	0.405
Lactobacillus × yeast	0.173	0.110	0.226	0.0003	0.038	0.020	0.021
Orthogonal Polynomials contrasts
Linear Lactobacillus	0.602	0.555	0.113	0.976	0.032	0.102	0.064
Quadratic Lactobacillus	0.022	0.037	0.531	0.007	0.071	0.066	0.062
Linear yeast	0.178	0.438	0.094	0.002	0.622	0.801	0.746
Quadratic yeast	0.001	0.084	0.568	0.125	0.210	0.201	0.193

^a–cMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means. RBC: Red blood cell; WBC: White blood cell; H/L ratio: Heterophil to lymphocyte.

Table 6. Effects of Lactobacillus sp. and yeast in deoxynivalenol contaminated diets on duodenum of broiler chickens at day 35 of age.

Lactobacillus sp. (g/kg)	VH (µm)	VW (µm)	CD (µm)	VH:CD	Muscular layer (µm)	Mucosa (µm)	VSA (mm^2)	ASAA (µm^2)
0	753.59^b	219.18	132.46^b	6.01^ab	123.94	30.32	0.52	1583.78
0.20	876.42^a	200.32	139.82^ab	6.53^a	125.78	31.40	0.56	1692.74
0.40	815.61^ab	192.04	157.05^a	5.34^b	135.36	31.95	0.50	1574.04
SEM	26.11	9.06	6.35	0.27	4.48	1.13	0.03	43.85
Yeast (g/kg)
0	818.18	209.34	142.91	6.13	116.16^b	28.86^b	0.54	1650.80
0.75	833.46	200.16	149.73	5.75	131.48^a	30.17^b	0.53	1620.64
1.50	793.98	202.05	136.69	5.99	137.43^a	34.64^a	0.51	1579.12
SEM	26.11	9.06	6.35	0.265	4.48	1.13	0.03	43.85
Lactobacillus sp. ×Yeast
0 × 0	731.02	232.61	141.65	5.59	118.51^bc	28.14	0.52	1598.31
0 × 0.75	777.14	221.68	142.57	5.70	123.88^bc	31.06	0.54	1619.77
0 × 1.50	752.63	203.26	113.17	6.75	129.43^abc	31.74	0.49	1533.25
0.20 × 0	853.87	204.36	128.52	7.07	113.56^c	27.03	0.58	1718.29
0.20 × 0.75	900.95	190.93	144.20	6.42	111.19^c	31.50	0.55	1673.03
0.20 × 1.50	874.43	205.67	146.73	6.08	152.57^ab	35.68	0.57	1686.89
0.40 × 0	869.64	191.04	158.57	5.72	116.41^c	31.42	0.53	1635.79
0.40 × 0.75	822.31	187.86	162.41	5.13	159.36^a	27.94	0.49	1569.12
0.40 × 1.50	754.88	197.21	150.16	5.17	130.31^abc	36.50	0.47	1517.21
SEM	45.22	15.70	10.99	0.46	7.77	1.95	0.05	75.95
P-Value
Lactobacillus sp.	0.006	0.103	0.024	0.009	0.163	0.581	0.261	0.113
Yeast	0.562	0.752	0.354	0.598	0.004	0.002	0.696	0.514
Lactobacillus sp. ×Yeast	0.537	0.747	0.323	0.197	0.0006	0.149	0.939	0.942
Orthogonal polynomials contrasts
Linear Lactobacillus sp.	0.098	0.038	0.008	0.077	0.077	0.308	0.674	0.876
Quadratic Lactobacillus sp.	0.006	0.635	0.528	0.011	0.483	0.847	0.114	0.038
Linear yeast	0.515	0.572	0.490	0.733	0.001	0.0006	0.396	0.252
Quadratic yeast	0.395	0.620	0.206	0.341	0.397	0.255	0.986	0.916

^a–cMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means; VH: Villus height; VW: Villus width; CD: Crypt depth; VSA: Villus surface area; AASA: Apparent absorptive surface area.

Table 7. Effects of Lactobacillus sp. and yeast in deoxynivalenol contaminated diets on jejunum of broiler chickens at day 35 of age.

Lactobacillus sp. (g/kg)	VH (µm)	WV (µm)	CD (µm)	VH:CD	Muscular layer (µm)	Mucosa (µm)	VSA (mm^2)	AASA (µm^2)
0	2086.00^ab	198.69	153.16^b	14.3800	150.32	30.64	1.30	3119.12^ab
0.20	1997.28^b	190.69	166.63^ab	12.6329	152.85	30.47	1.20	2987.86^b
0.40	2189.43^a	193.91	175.31^a	13.0042	161.13	30.55	1.33	3228.42^a
SEM	36.79	6.30	6.40	0.57	4.67	1.11	0.05	48.65
Yeast (g/kg)
0	2122.43	200.40	158.65^b	13.88^a	141.20^b	29.73	1.34	3168.15
0.75	2036.77	187.47	181.40^a	11.75^b	163.90^a	29.28	1.20	3142.00
1.50	2113.51	195.42	155.06^b	14.39^a	159.21^a	32.65	1.30	3025.25
SEM	36.79	6.30	6.40	0.57	4.67	1.11	0.05	48.65
Lactobacillus× Yeast
0 × 0	2020.95	185.85	179.78^ab	11.91^bc	125.53	25.29^b	1.18^ab	3001.27^ab
0 × 0.75	2101.46	205.95	150.45^abc	14.48^ab	161.94	33.07^a	1.36^ab	3160.20^ab
0 × 1.50	2135.58	204.26	129.24^c	16.75^a	163.49	33.55^a	1.37^ab	3195.90^ab
0.20 × 0	2092.75	206.49	140.72^bc	15.07^ab	146.81	30.42^ab	1.35^ab	3151.39^ab
0.20 × 0.75	1916.49	172.84	197.17^a	9.78^c	158.40	28.92^ab	1.04^ab	2835.59^b
0.20 × 1.50	1982.60	192.73	162.01^abc	13.05^abc	153.35	32.07^a	1.20^b	2976.59^ab
0.40 × 0	2253.59	208.87	155.44^abc	14.68^ab	151.26	33.46^a	1.47^a	3351.79^a
0.40 × 0.75	2092.35	183.60	196.57^a	10.98^bc	171.34	25.86^b	1.21^ab	3079.98^ab
0.40 × 1.50	2222.35	189.24	173.93^abc	13.35^abc	160.79	32.32^a	1.32^ab	3253.51^a
SEM	63.73	10.91	11.09	0.98	8.09	1.91	0.08	84.26
P-Value
Lactobacillus sp.	0.002	0.666	0.023	0.080	0.239	0.994	0.120	0.004
Yeast	0.203	0.348	0.006	0.004	0.003	0.072	0.137	0.095
Lactobacillus ×Yeast	0.218	0.117	0.0009	0.0007	0.294	0.005	0.027	0.043
Orthogonal Polynomials contrasts
Linear Lactobacillus sp.	0.051	0.593	0.007	0.091	0.107	0.956	0.657	0.117
Quadratic Lactobacillus sp.	0.003	0.470	0.654	0.132	0.617	0.928	0.045	0.003
Linear yeast	0.865	0.578	0.647	0.534	0.008	0.066	0.561	0.705
Quadratic yeast	0.076	0.181	0.002	0.001	0.020	0.164	0.057	0.033

^a–cMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means; VH: Villus height; VW: Villus width; CD: Crypt depth; VSA: Villus surface area; AASA: Apparent absorptive surface area.

Table 8. Effects of Lactobacillus sp. and yeast in deoxynivalenol diets on ileum of broiler chickens at day 35 of age.

Lactobacillus (g/kg)	VH (µm)	WV (µm)	CD (µm)	VH:CD	Muscular layer (µm)	Mucosa (µm)	VSA (mm^2)	ASAA (µm^2)
0	1079.44^b	201.24	150.58^b	7.38	119.81^b	29.405	0.67^ab	1919.15^b
0.20	1072.75^b	186.88	153.25^b	7.34	129.40^ab	30.236	0.63^b	1866.61^b
0.40	1211.54^a	187.42	177.12^a	7.10	145.23^a	31.993	0.71^a	2034.84^a
SEM	29.39	5.133	6.37	0.32	5.25	1.16	0.02	33.18
Yeast (g/kg)
0	1064.48^b	184.529	156.66^ab	7.03^b	112.551^b	29.51^b	0.61^b	1849.41^b
0.75	1109.92^ab	192.067	176.36^a	6.65^b	141.80^a	28.29^b	0.67^b	1927.30^b
1.50	1189.33^a	198.934	147.92^b	8.13^a	140.09^a	33.83^a	0.74^a	2043.89^a
SEM	29.39	5.13	6.37	0.32	5.25	1.16	0.02	33.18
Lactobacillus ×Yeast
0 × 0	1192.27^abc	189.46	152.52	7.87^ab	110.96^bc	28.21	0.69^abcd	2018.05^abc
0 × 0.75	1033.83^bc	203.64	167.91	6.40^ab	132.35^abc	29.17	0.66^abcd	1871.85^bcd
0 × 1.50	1012.21^bc	210.61	131.30	7.87^ab	116.14^bc	30.84	0.67^abcd	1867.54^bcd
0.20 × 0	971.09^c	184.21	134.40	7.38^ab	104.60^c	29.19	0.56^d	1736.36^d
0.20 × 0.75	1017.02^bc	185.66	179.83	6.10^ab	149.28^ab	28.53	0.59^bcd	1795.96 ^cd
0.20 × 1.50	1230.13^ab	190.76	145.50	8.54^a	134.31^abc	32.99	0.73^abc	2067.52^ab
0.40 × 0	1030.07^bc	179.92	183.07	5.84^b	122.09^bc	31.14	0.58 ^cd	1793.83 ^cd
0.40 × 0.75	1278.90^a	186.91	181.34	7.45^ab	143.78^abc	27.18	0.75^ab	2114.09^ab
0.40 × 1.50	1325.65^a	195.43	166.95	7.99^ab	169.82^a	37.66	0.81^a	2196.60^a
SEM	50.90	8.89	11.02	0.56	9.09	2.01	0.04	57.48
p-Value
Lactobacillus	0.002	0.089	0.008	0.800	0.004	0.281	0.017	0.002
Yeast	0.013	0.148	0.008	0.005	0.0002	0.003	0.0002	0.0005
Lactobacillus ×Yeast	<.0001	0.934	0.244	0.039	0.056	0.296	0.005	<.0001
Orthogonal Polynomials contrasts
Linear Lactobacillus	0.002	0.062	0.005	0.539	0.001	0.120	0.161	0.016
Quadratic Lactobacillus	0.048	0.240	0.179	0.799	0.629	0.746	0.012	0.009
Linear Yeast	0.004	0.052	0.335	0.018	0.0004	0.011	<.0001	0.0001
Quadratic Yeast	0.639	0.958	0.003	0.022	0.019	0.021	0.777	0.636

^a–dMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means. VH: Villus height; VW: Villus width; CD: Crypt depth; VSA: Villus surface area; AASA: Apparent absorptive surface area.

Table 9. Effect of Lactobacillus sp. and yeast in deoxynivalenol diets on jejunal gene expressions of broiler chickens at day 35 of age.

Lactobacillus sp. (g/kg)	CLDN-5	MUC-2	TLR-4
0	0.63	1.40	0.89^ab
0.2	0.52	1.24	1.65^a
0.4	0.87	1.05	0.44^b
SEM	0.12	0.17	0.38
Yeast (g/kg)
0	0.73	0.63	0.56
0.75	0.73	1.29	1.01
1.50	0.56	1.76	1.41
SEM	0.12	0.17	0.38
Lactobacillus sp. ×Yeast
0 × 0	1.00^a	1.00	1.00^ab
0 × 0.75	0.80^ab	0.50	0.84^ab
0 × 1.50	0.10^b	2.69	0.84^ab
0.20 × 0	0.68^ab	0.22	0.23^b
0.20 × 0.75	0.57^ab	1.58	1.49^ab
0.20 × 1.50	0.31^ab	1.93	3.22^a
0.40 × 0	0.52^ab	0.66	0.45^ab
0.40 × 0.75	0.82^ab	1.80	0.69^ab
0.40 × 1.50	1.27^a	0.68	0.18^b
SEM	0.21	0.29	0.65
P-Value
Lactobacillus sp.	0.325	0.633	0.030
Yeast	0.300	0.163	0.395
Lactobacillus sp. ×Yeast	0.002	0.208	0.046
Orthogonal polynomials contrasts
Linear Lactobacillus sp.	0.295	0.344	0.079
Quadratic Lactobacillus sp.	0.281	0.950	0.039
Linear yeast	0.160	0.059	0.214
Quadratic yeast	0.520	0.969	0.585

^a–bMeans in the same column with different superscripts differ significantly (p < .05). SEM: Standard error of means. CLDN-5: Claudin-5; MUC-2: Mucin-2; TLR-4: Toll like receptor-4.