Effects of dietary fat source and green tea (Camellia sinensis) extract on genes associated with lipid metabolism and inflammatory responses in female broiler chickens

Figures & data

Table 1. Ingredients and chemical composition of the diets¹.

Growth phase		Starter		Grower			Finisher
Ingredients (percenatge as fed basis)	Without fat	Soybean oil	Tallow	Without fat	Soybean oil	Tallow	Without Fat	Soybean oil	Tallow
Corn grain	60.47	56.78	56.35	64.16	53.92	52.54	67.42	59.81	58.30
Soybean meal	35.18	37.52	37.59	32.17	37.60	37.88	29.24	31.47	31.76
Soybean oil/tallow	00.00	1.28	1.59	00.00	4.60	5.71	00.00	5.05	6.28
DCP	1.58	1.67	1.67	1.33	1.47	1.47	1.09	1.26	1.26
Calcium carbonate	1.32	1.35	1.35	1.11	1.15	1.15	1.00	1.05	1.05
Common salt	0.25	0.26	0.26	0.29	0.30	0.30	0.29	0.28	0.28
Sodium bicarbonate	0.28	0.26	0.26	0.22	0.21	0.21	0.23	0.25	0.24
dl-Methionine	0.29	0.30	0.31	0.20	0.23	0.23	0.20	0.26	0.26
l-Lysine HCL	0.14	0.12	0.11	0.02	0.01	0.01	0.03	0.07	0.07
Vitamin premix^2	0.25	0.25	0.25	0.25	0.25	0.25	0.25	0.25	0.25
Mineral premix^3	0.25	0.25	0.2	0.25	0.25	0.25	0.25	0.25	0.25
Nutrients analysis
ME, kcal/kg	2770	2850	2850	2849	3050	3050	2900	3150	3150
Crud protein %	20.80	21.5	21.5	19.80	21.29	21.29	18.80	19.11	19.11
Calcium %	0.95	0.99	0.99	0.81	0.87	0.87	0.71	0.77	0.77
Available P %	0.45	0.47	0.47	0.40	0.43	0.43	0.35	0.38	0.38
Potassium %	0.88	0.92	0.92	0.83	0.91	0.91	0.78	0.81	0.81
Chlorine %	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22
Sodium%	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20
Lysine%	1.30	1.34	1.34	1.11	1.24	1.24	1.05	1.13	1.13
Methionine %	0.62	0.64	0.64	0.52	0.56	0.56	0.50	0.57	0.57
Met + Cys%	0.97	1.00	1.00	0.85	0.92	0.92	0.82	0.89	0.89
Threonine %	0.87	0.90	0.9	0.83	0.89	0.89	0.79	0.80	0.80

¹Each of the experimental diets was prepared at two different levels of 0 and 500 mg GTE/kg of diet.

²1kg vitamin premix contains: vitamin A (500,000 U/g): 1.8 g; vitamin B1 (98.8%): 0.18 g; B6 (98.5%): 0.3 g; vitamin B12 (1%): 0.15 g; vitamin D3 (500,000 U/g): 0.4 g; vitamin E (500 U/g): 3.6 g; vitamin K3 (50%): 0.4 g; vitamin B9 (80%): 0.125 g; vitamin B5 (99%): 3 g and vitamin H2 (2%): 0.5 g.

³1kg mineral premix contains: Mn (MnO4 62%): 16 g; Fe (FeSO4 20%): 25 g; Zn (ZnO 77%): 11 g; Cu (CuSO4 25%): 4 g; I (CaI 62%): 0.16 g and Se (1%): 2 g.

ME: metabolizable energy.

Table 2. Oligonucleotide primer sequence for RT-PCR amplification.

Gene name	NCBI Reference	Primer	Sequences (5ˊ→3ˊ)	Product size, bp
β-Actin	NM_205518	forward	GGAAGTTACTCGCCTCTG	109
		reverse	AAAGACACTTGTTGGGTTAC
ATGL	NM_113291	forward	TCACCTTCAGCGTCCAAGTC	186
		reverse	GCACATGCCTCCAAAAGAGC
LPL	NM_205282	forward	GACCTTAATTGTCGCATCCAT	97
		reverse	CGGGAAGGACTTTATGTATGA
TNF-α	JN-942589	forward	AGACCAGATGGGAAGGGAATGAA	219
		reverse	GAAGAGGCCACCACACGACAG
IL-6	NM_204628	forward	AAATCCCTCCTCGCCAATCT	106
		reverse	CCCTCACGGTCTTCTCCATAAA

Table 3. The effects of dietary green tea extract (GTE) and fat sources on growth performance of female broiler chicks at 49 days of age.

	Feed intake, g/chick/d	Body weight gain, g/chick/d	Feed conversion ratio	Energy intake, kal/d
Dietary level of GTE
GTE0	96.09	53.88	1.78	292.07
GTE500	98.17	54.42	1.80	298.13
SEM	1.17	0.66	0.02	3.56
p Value	.22	.57	.60	.88
Fat sources
SO0, Ta0	97.72	51.77^b	1.88^a	281.4^b
SO	97.15	55.37^a	1.75^b	302.70^a
Ta	96.47	55.30^a	1.74^b	300.67^a
SEM	0.64	0.81	0.03	4.36
p Value	.81	.006	.008	.01
The Interactions
GTE0, SO0, Ta0	96.83	51.59	1.88	280.67
GTE0, SO	96.12	55.60	1.73	302.66
GTE0, Ta	95.42	54.45	1.75	300.54
GTE500, SO0, Ta0	98.64	51.96	1.89	282.21
GTE500, SO	97.17	55.15	1.76	302.75
GTE500, Ta	97.53	55.16	1.76	300.81
SEM	1.73	1.25	0.04	5.33
p Value	.26	.31	.25	.98

^a,bMeans followed by different letters in the same columns are significantly different (p < 0.05).

GTE₀: without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Table 4. The effects of dietary green tea extract (GTE) and fat sources on carcase yield (CY), abdominal fat (AF), blood triglyceride concentration (Blood TG), liver fat (LF), and liver MT (LMT) content in female broiler chicks at 49 days of age.

	CY, %	Blood TG, mg/dL	AF, %	LF, %
GTE levels, mg/kg diet
GTE0	65.48	121.16	2.91	13.20
GTE500	65.93	116.13	2.65	13.90
SEM	0.52	4.85	0.11	0.36
p Value	.50	.41	.10	.19
Fat sources
SO0, Ta0	67.41^a	105.90^b	2.32^b	12.10^b
SO	64.32^b	132.90^a	3.17^a	15.05^a
Ta	65.40^ab	115.70^ab	2.87^ab	13.50^ab
SEM	0.65	5.94	0.12	0.45
p Value	.02	.02	.001	.003
The Interactions
GTE0, SO0, Ta0	66.97^a	105.60^b	2.30^b	12.23^b
GTE0, SO	64.12^b	140.60^a	3.40^a	14.41^ab
GTE0, Ta	65.22^ab	116.60^ab	3.00^ab	12.96^ab
GTE500, SO0, Ta0	67.81^a	105.20^b	2.33^b	11.96^b
GTE500, SO	64.49^ab	125.20^ab	2.99^ab	15.70^a
GTE500, Ta	65.49^ab	114.70^ab	2.73^ab	14.05^ab
SEM	0.94	8.40	0.18	0.64
p Value	.048	.04	.002	.02

^a,bMeans followed by different letters in the same columns are significantly different (p < 0.05).

GTE₀: Without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Figure 1. QRT-PCR analysis of LPL (lipoprotein lipase) gene expression in abdominal fat tissue of female broiler chicks in response to green tee extract (GTE) and fat supplementation. GTE₀: without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Figure 2. QRT-PCR analysis of ATGL (adipose triglyceride lipase) gene expression in abdominal fat tissue of female broiler chicks in response to green tee extract (GTE) and fat supplementation. GTE₀: without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Figure 3. QRT-PCR analysis TNF-α (tumour necrosis factor α) in abdominal fat tissue of female broiler chicks in response to green tee extract (GTE) and fat supplementation. GTE₀: without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: Soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Table 5. The effects of dietary green tea extract (GTE) and fat sources LMT and some relative immune organs weight (Bursa of Fabricius (BF), thymus and spleen) in female broiler chicks at 49 days of age.

	LMT, µmol/gr liver	BF, %	Thymus, %	Spleen, %
GTE levels, mg/kg diet
GTE0	0.222	0.1	0.7	0.17
GTE500	0.219	0.11	0.61	0.15
SEM	0.003	0.002	0.005	0.003
p Value	.53	.44	.35	.22
Fat sources
SO0, Ta0	0.217	0.09	0.67	0.16
SO	0.227	0.11	0.66	0.17
Ta	0.217	0.11	0.62	0.15
SEM	0.003	0.002	0.005	0.003
p Value	.16	.7	.58	.75
The Interactions
GTE0, SO0, Ta0	0.221	0.1	0.77	0.19
GTE0, SO	0.231	0.13	0.61	0.16
GTE0, Ta	0.214	0.09	0.7	0.18
GTE500, SO0, Ta0	0.214	0.09	0.57	0.14
GTE500, SO	0.222	0.12	0.71	0.19
GTE500, Ta	0.221	0.11	0.55	0.13
SEM	0.005	0.002	0.006	0.004
p Value	.30	.59	.07	.98

GTE₀: without green tea extract; GTE₅₀₀: 500 mg green tea extract/kg diet; SO: soybean oil; Ta: tallow; SO₀/Ta₀: without soybean oil/without tallow.

Alagawany M, Abd El‐Hack ME, Saeed M, Naveed M, Arain MA, Arif M, Tiwari R, Khandia R, Khurana SK, Karthik K, et al. 2020. Nutritional applications and beneficial health applications of green tea and l-theanine in some animal species: A review. J Anim Physiol Anim Nutr (Berl)). 104(1):245–256.

 PubMed Web of Science ®Google Scholar

Al-Zghoul MB, Saleh KM, Ababneh MMK. 2019. Effects of pre-hatch thermal manipulation and post-hatch acute heat stress on the mRNA expression of interleukin-6 and genes involved in its induction pathways in 2 broiler chicken breeds. Poult Sci. 98(4):1805–1819.

 PubMed Web of Science ®Google Scholar

AOAC 2005. Official method of Analysis. 18th Edition, Association of Officiating Analytical Chemists, Washington DC, Method 935.14 and 992.24.

 Google Scholar