Effects of dried yeast, a byproduct of the brewery industry, on the egg production and quality and the immune response of laying hens

Figures & data

Table 1. Chemical composition of the basal diet.

Ingredients	%
Ash	13.6
Crude protein	19.5
Crude carbohydrate	49.8
Crude fat	3.97
Crude fibre	4.34
Calcium	3.66
Total phosphorus	0.700
Lysine	1.196
Methionine + cysteine	0.451
Metabolizable energy (ME), kcal/kg	2,800

Table 2. Primer sequences of immune response-related genes used in the quantitative RT-PCR assay.

Name	Primer sequence (5′ to 3′)	Reference	NCBI accession number
Interleukin 1, beta (IL-1β)	F: GGGCATCAAGGGCTACAA R: CTGTCCAGGCGGTAGAAGA	Abdel-Mageed et al. (2017)	NM_204524
Interferon, gamma (IFNγ)	F: AGCTGACGGTGGACCTATTATT R: GGCTTTGCGCTGGATTC	Lee et al. (2015)	NM_205149
Interleukin 2 (IL-2)	F: TGCAGTGTTACCTGGGAGAA R: CTTGCATTCACTTCCGGTGT	Yarru et al. (2009)	–
Heat shock protein 90 (HSP90)	F: CAATTAACCCTCACTAAAGGG AGATCGCGCAGCTCATGTC R: CACCAGGTAGGCGGAGTAG	Rimoldi et al. (2015)	NM_206959

F: Forward; R: Reverse.

Table 3. Effects of dietary treatments on the performance of early-phase laying hens.

Traits	Control	Additive- fed	Probiotic- fed	SEM	p Value
Egg production, %
BF	74.0^B	73.8^B	70.7^B	3.159	.712
DF	85.3^Ab	93.8^Aa	86.3^Ab	2.375	.0455*
ASF	87.0^A	92.0^A	91.9^A	1.612	.0738
SEM	2.87	1.36	2.85	–	–
p-value	.0117*	<.0001**	.0003	–	–
Egg weight, g
BF	57.1	56.7	56.9	0.815	.946
DF	57.5	57.5	58.8	0.756	.399
ASF	58.4	57.9	57.8	0.629	.771
Egg mass, g/h/d
BF	42.2	41.9	40.3	2.08	.780
DF	49.0	53.9	50.8	1.47	.0866
ASF	50.9	53.2	53.2	1.21	.313
Feed intake, g/h/d	120	–	–	–	–
Feed conversion ratio, g/g
BF	2.88	2.88	3.04	0.146	.672
DF	2.47	2.23	2.38	0.0731	.104
ASF	2.37	2.26	2.27	0.0562	.295

BF, end of the 14-day basal diet feeding period, hens aged 27 weeks; DF, end of the 28-day experimental diet-feeding period after the initial basal diet feeding period, hens aged 31 weeks; ASF, end of the 28-day basal diet feeding period after the experimental diet feeding period, hens aged 35 weeks.

Statistical difference: *p < 0.05, **p < 0.01

^a,bMeans within a row are significantly different (p < .05).

^A,BMeans within a column are significantly different (p < .05).

Table 4. Effects of the dietary treatments on the quality of eggs produced by early-phase laying hens.

Traits	Control	Additive- fed	Probiotic- fed	SEM	p Value
%Yolk
BF	23.8	23.4	23.5	0.319	.662
DF	24.6	23.8	23.8	0.396	.280
ASF	25.0	24.3	24.7	0.382	.419
SEM	0.446	0.271	0.364	–	–
p-value	.184	.110	.104	–	–
Yolk colour
BF	9.06^B	8.92^B	9.08^B	0.0710	.378
DF	9.58^Ab	9.83^Ab	10.3^Aa	0.0875	.0002**
ASF	9.78^A	9.83^A	10.0^A	0.0918	.237
SEM	0.0748	0.0985	0.0762	–	–
p-value	<.0001**	<.0001**	<.0001**	–	–
%Albumen
BF	67.0	67.0^B	67.1	0.373	.957
DF	65.7^b	68.2^Aa	66.7^ab	0.405	.0023
ASF	65.5	66.3^C	65.8	0.367	.303
SEM	0.418	0.170	0.483	–	–
p-value	.0433	<.0001**	.196	–	–
Haugh unit
BF	95.0	94.7	95.0^A	1.43	.986
DF	93.4	92.8	92.3^AB	0.956	.713
ASF	93.6^ab	95.4^a	90.2^Bb	1.29	.0344*
SEM	1.27	1.39	1.05	–	–
p-value	.658	.421	.0188*	–	–
Eggshell weight, % of egg weight
BF	9.58	9.38	9.36	0.160	.571
DF	9.22	9.52	9.42	0.218	.625
ASF	9.56	9.34	9.53	0.149	.549
Eggshell thickness, mm
BF	0.567^A	0.544^A	0.530^A	0.0186	.364
DF	0.482^Bb	0.492^Bab	0.512^Aa	0.0065	.0226*
ASF	0.475^B	0.471^B	0.478^B	0.0057	.812
SEM	0.0177	0.0067	0.0080	–	–
p-value	.0037*	<.0001**	.0017	–	–

BF, end of the 14-day basal diet feeding period, hens aged 27 weeks; DF, end of the 28-day experimental diet-feeding period after the initial basal diet feeding period, hens aged 31 weeks; ASF, end of the 28-day basal diet feeding period after the experimental diet feeding period, hens aged 35 weeks.

Statistical difference: * p < 0.05, ** p < 0.01

^{a, b} Means within a row are significantly different (p < .05).

^{A, B} Means within a column are significantly different (p < .05).

Table 5. Effects of the dietary treatments on the size of eggs produced by early-phase laying hens.

Egg no.	Egg weight, g	Control, %			Additive-fed, %			Probiotic-fed, %
		BF	DF	ASF	BF	DF	ASF	BF	DF	ASF
0 (Jumbo)	>70	–	–	–	–	–	–	–	2.78	–
1 (Extra-large)	65–69	–	–	–	–	–	–	–	2.78	–
2 (Large)	60–64	25	194	27.8	25.0	25.0	16.7	16.7	22.2	27.8
3 (Medium)	55–59	528	639	61.1	38.9	50.0	75.0	50.0	63.9	52.8
4 (Small)	50–54	194	111	11.1	33.3	22.2	8.3	33.3	8.3	19.4
5 (Peewee)	45–49	2.78	2.78	–	2.78	2.78	–	–	–	–
Total price ($) per 100 eggs		9.70	9.42	9.80	9.61	9.68	9.75	9.60	9.93	9.75
Total price ($) per 300 eggs		28.9			29.0			29.3

Egg price ($): size 0 = 0.125; size 1 = 0.119; size 2 = 0.103; size 3 = 0.097; size 4 = 0.091; size 5 = 0.084; size 6 = 0.075 (DIT, 2020).

The price was based on the value from the Department of Internal Trade (DIT), Thailand, in Thai Baht currency and converted to USD.

Each period, the number of eggs was adjusted to 100 eggs.

An example of the calculation of egg price from the probiotic-fed group at DF:

BF (100 eggs): (17 × 0.103)+(50 × 0.097)+(33 × 0.091)=$9.60

DF (100 eggs): (3 x 0.125)+(3 × 0.119)+(22 × 0.103)+(64 × 0.097)+(8 × 0.091)=$9.93

ASF (100 eggs): (28 × 0.103)+(53 × 0.097)+(19 × 0.091)=$9.75

Total price of BF + DF + ASF = 9.69 + 9.93 + 9.75=$29.28

Total price of probiotic-fed group=$29.28 per 300 eggs

Figure 1. Effects of the dietary treatments on IL-1β, IL-2, IFNγ and HSP90 expression. The effects were calculated relative to the effects on the level of the housekeeping gene 18S rRNA in the control group. The bars represent the means ± SEMs. The letters a and b indicate a significant difference between groups at p<.05.

Abdel-Mageed AM, Nii T, Isobe N, Yoshimura Y. 2017. Modulatory roles of proinflammatory cytokines on the expression of cathelicidins in the lower regions of the oviduct of laying hens. Cytokines. 99:66–72.

 Google Scholar

Lee KW, Kim DK, Lillehoj HS, Jang SI, Lee SH. 2015. Immune modulation by Bacillus subtilis-based direct-fed microbials in commercial broiler chickens. Ani Feed Sci Tech. 200:76–85.

 Web of Science ®Google Scholar

Yarru LP, Settivari RS, Gowda NKS, Antoniou E, Ledoux DR, Rottinghaus GE. 2009. Effects of turmeric (Curcuma longa) on the expression of hepatic genes associated with biotransformation, antioxidant, and immune systems in broiler chicks fed aflatoxin. Poultry Sci. 88(12):2620–2627.

 PubMed Web of Science ®Google Scholar

Rimoldi S, Lasagna E, Sarti FM, Marelli SP, Cozzi MC, Bernardini G, Terova G. 2015. Expression profile of six stressrelated genes and productive performances of fast and slow growing broiler strains reared under heat stress conditions. Meta Gene. 6:17–25.

 PubMed Web of Science ®Google Scholar

Data availability statement

The data that support the findings of this study are available on request from the corresponding author, (WS). The data are not publicly available due to (restrictions e.g. their containing information that could compromise the privacy of research participants).