Growth performance, meat quality and lipid metabolism in finishing lambs fed diets containing rumen-unprotected and rumen-protected betaine

Figures & data

Table 1. Composition and nutrient levels of the diets (dry matter basis).

Ingredients	Content (%)
Peanut vine	30.00
Rice straw	11.00
Grounded corn	41.00
Soybean meal	16.00
Wheat bran	0.50
Premix^a	1.00
NaCl	0.50
Total	100.00
Nutritional levels^b
DM	89.16
ME/(MJ/kg)	10.03
CP	9.80
ADF	25.67
NDF	41.65
Ca	0.46
P	0.30

^aOne kg of premix contained the nutrients as following: VA, 150 KIU; VD₃, 45 KIU; VE, 200 mg; Zn, 1.0 g; Cu, 0.1 g; Mn, 1.0 mg; Fe, 0.8 g; Se, 4.0 mg.

^bThe nutrient levels were measured values except for ME (calculation based on ME values of each ingredient).

Table 2. Primer sequences for real time-qPCR.

Gene name	Accession no.	Primer sequences (5'–3')	Length (bp)	Melting temperature (°C)
ACC	NM_ 001009256.1	CCTGTCCGCCATTGACAT	171	57.2
		TAGGCGATATAAGCCCTTCG
FANS	XM_027974304.1	GCCAGACCAACTATGGGTTC	151	56.3
		ATGGCCTTGTCGTTAGTGC
LPL	NM_ 001009394.1	GCCCAGCAGCATTATCCAGT	88	59.8
		ATTCATCCGCCATCCAGTTC
GPAT1	XP_ 004020246.1	TGTGCTATCTGCTCTCCAATG	116	53.5
		CTCCGCCACTATAAGAATG
ACTB	NM_001009784.1	CACCGCAAATGCTTCTAGGC	96	60.4
		ACGAGGCCAATCTCATCTCG
GAPDH	XM_012166462.1	CCGTTCGACAGATAGCCGTA	81	58.7
		ATCCGTTCACTCCGACCTTC
RPL13	XM_015100414.1	GCAAAAAGGGCCAAGGAAGC	155	61.2
		CAAAGGTCAGACACACCCCA

ACC: acetyl-CoA carboxylase; FANS: fatty acid synthetase; LPL: lipoprotein lipase; GPAT1: glycerol-3-phosphate acyltransferase 1; ACTB: β-actin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; RPL13: ribosomal protein L13.

Table 3. Effects of RUPB and RPB on growth and slaughter performance of lambs.

Items	Groups			SEM	p-value
	Control	RUPB	RPB
Initial BW (kg)	21.74	21.77	21.75	0.845	.999
Final BW (kg)	32.79	32.98	33.27	1.474	.954
Average daily gain (g)	181.23	183.85	188.81	19.380	.926
Average daily feed intake (g)	1025.61	1057.19	999.13	74.540	.885
Feed:gain (g/g)	5.82	5.86	5.38	0.438	.424
Shrunk body weight (kg)	31.03	31.01	32.70	2.612	.768
Carcase weight (kg)	13.17	13.25	14.00	1.349	.800
Dressing percentage (%)	42.50	42.58	42.77	1.609	.985
Longissimus dorsi area (cm^2)	22.49	23.64	24.59	1.675	.496

Control: basal diets; RUPB: treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB: treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

BW: body weight.

Table 4. Effects of RUPB and RPB on serum biochemical indices of lambs.

Items	Groups			SEM	p-value
	Control	RUPB	RPB
ALB (g/L)	33.88	32.98	35.13	1.359	.329
TP (g/L)	36.40	37.50	40.68	3.191	.416
Urea (mmol/L)	10.00	10.74	11.45	1.320	.567
CHO (mmol/L)	1.57	1.47	1.39	0.240	.754
GLU (mmol/L)	5.30	5.44	5.57	0.163	.309
HDL (mmol/L)	0.88	0.95	1.03	0.101	.375
LDL (mmol/L)	0.67	0.50	0.70	0.009	.140
TG (mmol/L)	0.71	0.63	0.71	0.107	.714
FFA (mmol/L)	886.05	776.86	773.65	99.143	.466
GH (ng/mL)	12.16	10.31	9.60	2.389	.549
COR (ng/mL)	148.54	146.98	150.43	10.064	.943
RES (ng/mL)	117.69	141.55	147.58	17.756	.257
LEP (ng/mL)	15.20	16.71	16.45	1.707	.595
INS (μIU/mL)	57.52	51.80	45.58	6.042	.197
ADP (μg/mL)	2.47	2.03	2.15	0.003	.448

Control: basal diets; RUPB: treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB: treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

ALB: albumin; TP: total protein; CHO: cholesterol; GLU: glucose; HDL: high-density lipoprotein; LDL: low-density lipoprotein; TG: triglyceride; FFA: free fatty acid; GH: growth hormone; COR: cortisol; RES: resistin; LEP: leptin; INS: insulin; ADP: adiponectin.

Table 5. Effects of RUPB and RPB on the meat quality of lambs.

Items	Groups			SEM	p-value
	Control	RUPB	RPB
Water loss (%)	21.51^a	12.42^b	13.63^b	1.844	.005
Shear force(N)	21.93^a	22.55^a	15.54^b	1.602	.023
pH24 h	5.34	5.44	5.24	0.143	.199
L*	37.81	37.72	40.45	3.010	.561
a*	10.54^a	13.52^b	12.87^b	0.658	.009
b*	2.56	3.69	3.53	0.727	.314

^ab The values within a row with different superscripts are significantly different (p <.05).

Control; basal diets; RUPB: treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB: treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

L*: lightness; a*: redness; b*: yellowness.

Table 6. Effects of RUPB and RPB on fat deposition of lambs.

Items	Groups			SEM	p-value
	Control	RUPB	RPB
Subcutaneous fat thickness (cm)	0.23	0.27	0.29	0.048	.381
Abdominal fat weight (kg)	0.24	0.18	0.22	0.027	.176
Perirenal fat weight (kg)	0.08	0.08	0.10	0.011	.256
Tail fat weight (kg)	0.64	0.55	0.43	0.138	.353
IMF content (%)	2.53	2.21	3.60	0.639	.156
Abdominal fat index (%)	0.78^a	0.57^b	0.66^b	0.035	.010
Perirenal fat index (%)	0.26	0.24	0.29	0.014	.367
Tail fat index (%)	2.07	1.76	1.29	0.174	.930

^ab The values within a row with different superscripts are significantly different (p <.05).

Control: basal diets; RUPB: treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB: treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

IMF: intramuscular fat.

Table 7. Effects of RUPB and RPB on fatty acid composition of LD muscle in lambs.

Items	Groups			SEM	p Value
	Control	RUPB	RPB
C6:0	0.17	0.21	0.18	0.055	.778
C10:0	0.13	0.13	0.13	0.009	.989
C12:0	0.19	0.14	0.18	0.040	0.440
C13:0	0.02	0.02	0.01	0.003	.138
C14:0	2.91	2.77	2.65	0.277	.664
C14:1N5	0.07	0.06	0.06	0.012	.571
C15:0	0.32	0.29	0.31	0.037	.795
C15:1N5	0.38	0.27	0.28	0.089	.584
C16:0	21.07^a	20.43^b	22.59^a	0.675	.045
C16:1N7	1.59^a	1.33^b	1.63^a	0.082	.022
C17:0	0.85^b	0.99^a	0.95^ab	0.041	0.040
C17:1N7	0.42	0.42	0.41	0.085	.995
C18:0	20.74	20.82	20.57	0.867	.956
C18:1N9T	2.41	2.44	2.36	0.286	0.960
C18:1N9C	36.88	36.67	38.10	1.456	.598
C18:2N6T	1.37	1.41	1.18	0.160	.329
C18:2N6C	5.62	6.07	4.81	0.558	.152
C20:0	0.15	0.15	0.13	0.018	.493
C20:1	0.24	0.22	0.24	0.047	.955
C18:3N3	0.09	0.11	0.10	0.008	.334
C20:2	1.15^a	1.02^ab	0.74^b	0.121	.036
C22:0	0.14	0.16	0.14	0.017	.329
C20:3N3	2.77^ab	3.55^a	2.01^b	0.418	.029
C22:2N6	0.17	0.18	0.13	0.037	.463
C24:0	0.06	0.07	0.04	0.019	.494
C22:6N3	0.08	0.08	0.07	0.012	.398
MUFA	41.98	41.43	43.09	1.342	.495
PUFA	11.25^a	12.41^a	9.03^b	0.900	.025
SFA	46.76	46.17	47.88	1.225	.419
PUFA/SFA	0.24^ab	0.27^a	0.19^b	0.022	.028
N6PUFA	7.16	7.65	6.12	0.551	.078
N3PUFA	2.94^ab	3.74^a	2.18^b	0.419	.027
N6/N3PUFA	2.46	2.05	3.00	0.484	.221

^ab The values within a row with different superscripts are significantly different (p <.05).

Control: basal diets; RUPB: treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB: treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; SFA: saturated fatty acid.

Table 8. Effects of RUPB and RPB on fatty acid composition of subcutaneous adipose tissue in lambs.

Items	Groups			SEM	p-value
	Control	RUPB	RPB
C6:0	0.01	0.01	0.01	0.001	.726
C10:0	0.02	0.02	0.02	0.000	.648
C12:0	0.33	0.36	0.35	0.009	.527
C13:0	0.01	0.01	0.01	0.001	.850
C14:0	3.20	2.90	3.15	0.088	.371
C14:1N5	0.08	0.08	0.08	0.003	.839
C15:0	0.54	0.52	0.52	0.016	.834
C15:1N5	0.47	0.45	0.47	0.026	.948
C16:0	26.97^a	24.74^b	25.21^b	0.362	.002
C16:1N7	0.82	0.82	0.81	0.013	.950
C17:0	1.28	1.29	1.30	0.009	.654
C17:1N7	0.65	0.67	0.68	0.011	.755
C18:0	21.95	21.41	21.97	0.160	.307
C18:1N9T	0.47	0.48	0.49	0.009	.678
C18:1N9C	34.01^b	36.01^a	35.03^ab	0.325	.009
C18:2N6T	3.37	4.35	4.14	0.167	.066
C18:2N6C	3.67	3.69	3.56	0.084	.832
C20:0	0.52	0.51	0.51	0.021	.964
C20:1	0.17	0.17	0.17	0.002	.252
C18:3N3	0.96	1.01	0.95	0.024	.661
C20:2	0.03	0.03	0.03	0.001	.943
C22:0	0.15	0.15	0.15	0.002	.938
C20:3N3	0.02	0.02	0.02	0.001	.086
C22:2N6	0.23^b	0.22^b	0.27^a	0.008	.013
C24:0	0.05	0.06	0.06	0.002	.815
C22:6N3	0.03	0.03	0.03	0.001	.816
MUFA	36.67^b	38.67^a	37.74^a	0.325	.009
PUFA	8.30^b	9.36^a	9.00^ab	0.192	.041
SFA	55.03^a	51.97^c	53.26^b	0.474	.002
PUFA/SFA	0.15^b	0.18^a	0.17^a	0.005	.015
N6PUFA	7.26^b	8.27^a	7.97^a	0.177	.026
N3PUFA	1.00	1.06	1.00	0.024	.615
N6/N3PUFA	7.25	7.83	7.93	0.158	.171

^ab The values within a row with different superscripts are significantly different (p <.05).

Control: basal diets; RUPB, treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB, treatment with 2.9 g/kg dietary rumen-protected betaine supplementation.

MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; SFA: saturated fatty acid.

Figure 1. The relative abundance of mRNA for genes involved in lipid metabolism of LD muscle in lambs. Control, basal diets; RUPB, treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB, treatment with 2.9 g/kg dietary rumen-protected betaine supplementation. ACC: acetyl-CoA carboxylase; FANS: fatty acid synthetase; LPL: lipoprotein lipase; GPAT1: glycerol-3-phosphate acyltransferase 1.

Figure 2. The relative abundance of mRNA for genes involved in lipid metabolism of subcutaneous adipose tissue in lambs. Control, basal diets; RUPB, treatment with 1.6 g/kg dietary rumen-unprotected betaine supplementation; RPB, treatment with 2.9 g/kg dietary rumen-protected betaine supplementation. ACC: acetyl-CoA carboxylase; FANS: fatty acid synthetase; LPL: lipoprotein lipase; GPAT1: glycerol-3-phosphate acyltransferase 1.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.