In vitro effects of nonesterified fatty acids and β-hydroxybutyric acid on inflammatory cytokine expression in bovine peripheral blood leukocytes

Figures & data

Table 1. Quantitative PCR primer sequences for detecting selected inflammatory cytokines and GAPDH.

Gene symbol	GeneBank accession number		Product size (base-pair)
		Forward primer 5'–3' (F) Reverse primer 5'–3' (R)
GAPDH	NM_001034034.2	F: CAAGCTCATTTCCTGGTACGAC	130
		R: AACTCTTCCTCTCGTGCTCC
TNF-α	AF011926	F: CACATACCCTGCCACAAGGCT	238
		R: GGGCCGATTACCCCGAAGTG
IL-1β	NM_174093	F: GACGAGTTTCTGTGTGACGC	149
		R: ATGCAGAACACCACTTCTCGG
IL-6	NM_173923.2	F: TGAAAGCAGCAAGGAGACACT	99
		R: CAAATCGCCTGATTGAACCCAG
IL-8	AF232704	F: ATGACTTCCAAGCTGGCTGTTG	149
		R: TTGATAAATTTGGGGTGGAAAG
IL-10	NM_174088.1	F: CTGTTGACCCAGTCTCTGCT	216
		R: GCTCTTGTTTTCGCAGGGC

GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PCR: polymerase chain reaction; TNF-α: tumour necrosis factor-α; IL-1β/-6/-8/-10: interleukin-1β/-6/-8/-10.

Figure 1. Morphological observation of isolated PBMCs and PMNLs from dry cows. (A) PBMCs were mainly lymphocytes (black arrow), with some monocytes (white arrow). (B) PMNLs were mainly neutrophils (white arrow), with some eosinophils (black arrow). PBMCs: Peripheral blood mononuclear cells; PMNLs: Polymorphonuclear leukocytes.

Table 2. Viability of PBMCs and PMNLs under NEFA or BHBA treatment alone and in combination with LPS for 4 h.

	PBMC (%)				PMNL (%)
	−LPS		+LPS		−LPS		+LPS
	Mean	± SE	Mean	± SE	Mean	± SE	Mean	± SE
Control	88.3	0.5	88.9	0.7	93.8	1.6	91.4	2.8
NEFA (mM)
0.1	87.9	0.5	89.2	0.7	95.4	0.9	94.6	1.3
0.6	87.6	0.8	88.0	0.6	96.3	0.6	95.2	2.5
1.5	87.2	0.4	85.9	0.9	97.2	0.4	94.2	1.5
p value	.341		.004*		.124		.245
BHBA (mM)
5	87.4	1.1	88.7	1.1	93.8	1.73	89.5	3.1
10	88	1.1	88.9	1.0	93.8	1.72	89.2	4.3
p value	.759		.922		.999		.995

Before treatment, the average viabilities of the isolated PBMCs and PMNLs were 93.4% ± 0.6% and 98.1% ± 0.4%, respectively. Data are presented as means ± SEs. p values represent the results of one-way ANOVA with Tukey’s post hoc test. * indicates p < .05 and is considered as statistical significance.

PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); NEFA: Nonesterified fatty acids; BHBA: β-hydroxybutyric acid; LPS: Lipopolysaccharides; SE: Standard error; One-way ANOVA: One-way analysis of variance.

Figure 2. Cytokine expression induced by combination treatment of NEFA with LPS in PBMCs and PMNLs. PBMCs and PMNLs were treated with 0.1, 0.6, and 1.5 mM NEFA alone or with 1 µg/mL LPS for 4 h. The mRNA expression levels of TNF-α, IL-1β, IL-6, IL-8, and IL-10 were determined through real-time PCR. Data are presented as means ± SEs. p values represent comparisons between two groups through one-way ANOVA; a p value of <.05 denotes statistical significance. * indicates p < .05, and ** indicates p < .01. NEFA: Nonesterified fatty acids; LPS: Lipopolysaccharides; PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); mRNA: messenger ribonucleic acid; TNF-α: Tumor necrosis factor-α; IL-1β: Interleukin-1β; IL-6: Interleukin-6;IL-8: Interleukin-8; IL-10: Interleukin-10; PCR: Polymerase chain reaction; SEs: Standard errors; One-way ANOVA: One-way analysis of variance.

Table 3. Analysis of dose-dependent and combination effects on cytokine expression induced by NEFA alone or in combination with LPS treatment in PMNLs and PBMCs.

	TNF-α		IL-1β		IL-6		IL-8		IL-10
	Mean	± SE	Mean	± SE	Mean	± SE	Mean	± SE	Mean	± SE
PMNLs
NEFA alone (mM)
0	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01
0.1	0.99	0.28	1.01	0.14	1.4	0.14	1.13	0.16	1.14	0.19
0.6	0.83	0.08	1.41	0.14	1.76	0.15	1.75	0.09	1.36	0.14
1.5	0.61	0.10	2.17	0.42	2.66	0.21	1.74	0.24	1.58	0.24
p value	.285		.005**		<.001**		.014*		.108
NEFA (mM) + LPS
0	13.57	2.63	8.69	1.79	4.92	0.99	5.87	1.28	7.67	1.47
0.1	16.19	3.19	10.97	2.82	6.67	1.46	7.42	1.72	8.92	1.89
0.6	14.1	2.32	12.17	2.96	7.72	1.23	8.25	1.51	9.24	1.29
1.5	7.87	1.27	21.13	6.36	11.72	1.30	14.73	4.34	11.15	1.40
p value	.128		.145		.007**		.097		.472
PBMCs
NEFA alone (mM)
0	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01
0.1	1.18	0.05	1.09	0.05	1.09	0.04	0.99	0.04	0.9	0.03
0.6	1.32	0.06	1.54	0.16	1.27	0.09	1.37	0.11	1.09	0.06
1.5	1.59	0.12	2.13	0.23	1.03	0.03	1.89	0.15	1.27	0.11
p value	<.001**		<.001**		.007**		<.001**		.005**
NEFA (mM) + LPS
0	1.18	0.05	1.12	0.10	1.31	0.12	1.08	0.74	1.23	0.08
0.1	1.31	0.11	1.23	0.19	1.38	0.18	1.12	0.14	1.33	0.17
0.6	1.46	0.14	1.61	0.30	1.45	0.18	1.33	0.20	1.55	0.19
1.5	1.7	0.09	2.72	0.38	1.51	0.17	2.02	0.23	2.2	0.17
p value	.012*		.001**		.864		.003**		.001**

Data indicate the fold change of expression levels compared with those of the control group and are presented as means ± SEs. p values represent the results of one-way ANOVA with Tukey’s post hoc test. * indicates p < .05, and ** indicates p < .01.

NEFA: Nonesterified fatty acids; LPS: Lipopolysaccharides; PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); TNF-α: Tumor necrosis factor-α; IL-1β: Interleukin-1β; IL-6: Interleukin-6;IL-8: Interleukin-8; IL-10: Interleukin-10; SE(s): Standard error(s); One-way ANOVA: One-way analysis of variance.

Figure 3. Summary of findings suggesting effects of NEFA and LPS on inflammatory cytokine expression in bovine PBMCs and PMNLs. Under NEB, NEFA induces inflammatory cytokine expression, and when combined with exposure to a pathogen (e.g. LPS), the expression levels of these inflammatory cytokines are further increased, resulting in excessive inflammatory response. +, induction by NEFA treatment; ++, synergistic induction by NEFA and LPS combination treatment; –, suppression by NEFA treatment; *, dose-dependent induction by NEFA treatment. Grey font, no significant induction or suppression identified. NEFA: Nonesterified fatty acids; LPS: Lipopolysaccharides; PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); NEB: Negative energy balance; TNF-α: Tumor necrosis factor-α; IL-1β: Interleukin-1β; IL-6: Interleukin-6;IL-8: Interleukin-8; IL-10: Interleukin-10.

Figure 4. Cytokine expression induced by combination treatment of BHBA with LPS in PBMCs and PMNLs. PBMCs and PMNLs were treated for 4 h with 0, 5, and 10 mM BHBA, either alone or with 1 µg/mL LPS. The mRNA expression levels of TNF-α, IL-1β, IL-6, IL-8, and IL-10 were determined through real-time PCR. Data are presented as the mean ± SE. *, p values represent comparisons between two groups through one-way ANOVA; a value of <.05 denotes statistical significance. * indicates p < .05, and ** indicates p < .01. BHBA: β-hydroxybutyric acid; LPS: Lipopolysaccharides; PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); mRNA: messenger ribonucleic acid; TNF-α: Tumor necrosis factor-α; IL-1β: Interleukin-1β; IL-6: Interleukin-6;IL-8: Interleukin-8; IL-10: Interleukin-10; PCR: Polymerase chain reaction; SEs: Standard errors; One-way ANOVA: One-way analysis of variance.

Table 4. Analysis of dose-dependent and combination effects on cytokine expression induced by BHBA alone or in combination with LPS treatment in PMNLs and PBMCs.

	TNF-α		IL-1β		IL-6		IL-8		IL-10
	Mean	± SE	Mean	± SE	Mean	± SE	Mean	± SE	Mean	± SE
PMNLs
BHBA alone (mM)
0	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01
5	1.27	0.35	2.01	0.71	0.68	0.13	1.02	0.23	1.90	0.71
10	1.15	0.16	1.99	1.06	0.81	0.11	1.04	0.24	1.30	0.36
p value	.704		.551		.114		.986		.394
BHBA (mM) + LPS
0	8.95	2.19	9.85	2.84	5.31	2.63	3.29	0.95	7.33	2.52
5	10.12	4.15	9.49	3.58	6.18	3.21	2.83	0.92	6.77	2.41
10	9.26	2.76	12.73	4.36	6.81	3.07	5.07	1.72	10.84	1.94
p value	.964		.791		.939		.434		.341
PBMCs
BHBA alone (mM)
0	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01	1.00	0.01
5	0.97	0.04	1.24	0.17	0.84	0.08	1.09	0.14	0.84	0.07
10	1.18	0.07	2.08	0.28	1.15	0.18	1.60	0.16	1.11	0.11
p value	.011*		.001**		.202		.005**		.066
BHBA (mM) + LPS
0	1.27	0.05	12.88	9.47	2.55	0.75	2.86	1.02	8.29	4.01
5	1.37	0.06	14.69	10.59	2.54	0.73	2.78	1.03	7.41	3.27
10	1.42	0.07	14.41	9.68	2.30	0.70	3.05	0.97	6.67	2.34
p value	.243		.99		.964		.981		.941

Data indicate the fold change in expression levels compared with those of the control group and are presented as means ± SEs. p values represent the results of one-way ANOVA with Tukey’s post hoc test. * indicates p < .05, and ** indicates p < .01.

NEFA: Nonesterified fatty acids; LPS: Lipopolysaccharides; PBMC(s): Peripheral blood mononuclear cell(s); PMNL(s): Polymorphonuclear leukocyte(s); TNF-α: Tumor necrosis factor-α; IL-1β: Interleukin-1β; IL-6: Interleukin-6;IL-8: Interleukin-8; IL-10: Interleukin-10; SE(s): Standard error(s); One-way ANOVA: One-way analysis of variance

Data availability statement

All data presented in this study are available upon request.