Carcase traits, meat quality, and lipogenic gene expression in muscle of lambs fed wheat bran feruloyl oligosaccharides

Figures & data

Table 1. Ingredient and chemical composition of basal diet (%, air-dry basis).

Item	Content
Ingredient
Chopped alfalfa hay (8 mm)	10.00
Chopped sunflower seed shells (8 mm)	20.00
Ground maize grain	43.00
Soybean meal (43% crude protein)	12.00
DDGS (27% crude protein)	10.00
Vitamin-mineral premix^a	5.00
Chemical composition
Digestible energy (MJ/day)^b	11.38
Crude protein	15.66
Ether extracts	3.48
Neutral detergent fibre	54.73
Acid detergent fibre	21.42
Ash	5.95
Calcium	0.74
Phosphorous	0.31

^aThe premix provided the following per kilogram: Ca, 130 g; P, 65 g; salt, 85 g; vitamin A, 140000 IU; vitamin D₃, 37500 IU; vitamin E, 375 mg; vitamin K₃, 25 mg; thiamine, 25 mg; pyridoxine, 25 mg; riboflavin, 75 mg; vitamin B₁₂, 0.28 mg; niacin, 300 mg; pantothenic acid, 200 mg; folic acid, 15 mg; biotin, 1.5 mg; Fe, 1300 mg; Cu, 200 mg; Zn, 1200 mg; Mn, 1000 mg; I, 9 mg; Se, 7 mg; Co, 12 mg.

^bCalculated value.

DDGS: distillers dried grains with solubles. DDGS are usually by-products produced in the production of industrial ethanol.

Table 2. Information of primer sequences of lipid metabolism genes.

Gene	GenBank No.	Primer Sequences (5′–3′)	Product size (bp)
SCD	NM_001009254.1	F: TTCTCCGTTACGCTGTTGTGCTC	158
		R: GGTGTGGTGGTAGTTGTGGAAGC
ACC	NM_001009256.1	F: GCTATGGAAGTCGGCTGTGGAAG	108
		R: TCGTCAGGAAGAGGCGGATGG
LPL	NM_001009394.1	F: CGCCGCCGACAGGATTACAAG	130
		R: GTTAGCCACAGATTCCGTCACTCC
FAS	XM_015098375.1	F: AGATGAAGGTGGTGGAGGTGCTAG	112
		R: TGGCGGTCAGTGGCTATGTAGTC
PPAR-γ	NM_001100921.1	F: TGCCGATTCCAGAAGTGCCTTG	118
		R: GTTGGTCGATGTCGCTGGAGATC
β-actin	NM_001009784.2	F: GAGCGCAAGTACTCCGTGTG	112
		R: CATTTGCGGTGGACGATG

PPARγ: peroxisome proliferator-activated receptor γ; LPL: lipoprotein lipase; ACC: acetyl-coenzyme A carboxylase; FAS: fatty acid synthase; SCD: stearoyl-coenzyme A desaturase.

Table 3. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on carcase traits of lambs.

Item	Treatment^a					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
Pre-slaughter live weight (kg)	33.060	32.660	32.730	34.720	33.290	0.484	.647
Hot carcase weight (kg)	17.760	17.600	17.530	18.360	18.050	0.341	.942
Dressing percentage (%)	53.770	53.820	53.650	52.710	54.110	0.489	.897
Loin eye area (cm^2)	24.500	22.710	23.000	24.000	23.710	0.562	.868
Total tissue depth (GR, mm)	19.330	19.890	18.290	20.090	20.170	0.711	.943

^aLambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Table 4. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on physical characteristics of Longissimus dorsi muscle in lambs.

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
pH45min	6.230	6.360	6.360	6.210	6.290	0.030	.376
Lightness (L*)	38.590	38.740	38.240	39.100	38.450	0.289	.924
Redness (a*)	9.650	9.920	9.770	9.450	9.890	0.167	.883
Yellowness (b*)	13.760	13.150	13.080	13.290	12.990	0.155	.561
Chroma (C*)	16.850	16.50	16.340	16.320	16.350	0.170	.864
Hue angle (H◦)	54.810	52.450	53.280	54.620	52.130	0.466	.251
Water loss rate (%)	12.310	11.230	12.510	12.190	10.570	0.309	.167
Cooking loss (%)	38.510	36.700	36.510	37.450	36.200	0.315	.112
Shear force (kg/cm^2)	8.090^a	7.170^c	7.330^b,c	7.890^a,b	7.800^a,b,c	0.107	.021

^a,b,cMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Table 5. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on chemical composition of Longissimus dorsi muscle in lambs (g/100 g Meat).

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
Moisture	76.690	76.300	75.910	77.000	76.140	0.160	.231
Crude protein	21.260^a	21.360^a	20.990^a	19.430^b	21.050^a	0.180	<.010
Ether extract	2.900^b	3.3770^a,b	3.480^a,b	3.830^a	2.820^b	0.110	<.010
Ash	1.340^b	1.890^a	2.000^a	1.780^a	1.860^a	0.050	<.010

^a,bMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Table 6. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on fatty acid composition of Longissimus dorsi muscle in lambs (% total fatty acids).

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
C12:0	0.140	0.130	0.090	0.120	0.100	0.012	.707
C14:0	2.020^a	1.980^a	1.730^a,b	1.270^b	1.550^a,b	0.085	.006
C14:1	0.060	0.080	0.060	0.060	0.060	0.004	.419
C16:0	41.520	39.440	38.640	35.530	39.660	0.734	.101
C16:1	1.260	1.530	1.440	1.360	1.500	0.058	.569
C18:0	7.610	7.520	7.910	7.410	7.580	0.141	.859
C18:1n − 9	11.680^c	12.960^b	12.440^b,c	14.250^a	11.530^c	0.268	<.001
C18:2n − 6	28.740^b	29.450^b	30.630^a,b	33.430^a	30.410^a,b	0.599	.036
C18:3n − 3	0.750^b	0.910^a	0.740^b	0.730^b	0.740^b	0.014	.001
C18:3n − 6	0.160^c	0.260^a	0.220^a,b	0.180^c	0.190^b,c	0.008	.001
C20:0	0.050	0.060	0.050	0.050	0.050	0.002	.059
C20:1	0.070^b	0.090^a	0.070^b	0.070^b	0.070^b	0.002	.001
C20:2	0.070	0.090	0.070	0.080	0.070	0.003	.067
C20:3n − 3	0.270	0.240	0.230	0.290	0.270	0.012	.656
C20:3n − 6	0.010	0.010	0.010	0.010	0.010	<0.001	.46
C20:4n − 6	4.720	4.470	4.700	4.400	5.120	0.125	.443
C20:5n − 3	0.300	0.260	0.260	0.270	0.30	0.014	.826
C22:0	0.010	0.010	0.010	0.010	0.010	0.001	.326
C22:1n − 9	0.110	0.150	0.130	0.110	0.120	0.006	.076
C22:2	0.010	0.010	0.010	0.010	0.010	0.001	.629
C22:6n − 3	0.420^d	0.710^a	0.540^c	0.510^c	0.640^b	0.025	<.001
ΣSFA	51.350^a	49.150^a	48.430^a	44.400^b	48.940^a	0.862	.004
ΣMUFA	13.200^b	14.810^a,b	14.130^a,b	15.840^a	13.280^b	0.316	.024
ΣPUFA	35.450^c	36.410^a,b	37.400^a,b	39.900^a	37.750^a,b	0.841	.041
Σn − 3	1.740^b	2.130^a	1.760^b	1.790^b	1.950^a,b	0.046	.032
Σn − 6	33.630	34.190	35.560	38.010	35.720	0.742	.293
UFA:SFA	0.950^b	1.040^b	1.060^a,b	1.260^a	1.040^b	0.034	.035
PUFA:SFA	0.690	0.740	0.770	0.900	0.770	0.026	.716

^a,b,c,dMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Figure 1. Effects of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on the mRNA expression of lipid metabolism genes in Longissimus dorsi muscle of lambs. Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB. Data are represented as mean ± SEM. Different letters above bars are significantly different (p < .05). Abbreviations: PPARγ, peroxisome proliferator-activated receptor γ; LPL, lipoprotein lipase; ACC: acetyl-coenzyme A carboxylase; FAS: fatty acid synthase; SCD: stearoyl-coenzyme A desaturase.

Data availability statement

The data that support the findings of this study are available from the corresponding authors upon reasonable request.