Effects of Phyllanthus emblica leaves and branches mixture on growth performance, oxidative status and intestinal characteristics in broiler chickens

Figures & data

Table 1. Ingredients and chemical composition (g/kg as fed) of the experimental diets for broilers¹.

Ingredients	Starter diet (1–21 days)	Finisher diet (22–35 days) g/kg
Corn, yellow	474.4	520.6
Soybean meal (CP 44%)	178.5	108
Soybean oil	1.1	6.5
Full fat soybean meal	300	325
Monocalcium phosphate	18.2	16.2
Calcium carbonate	16	13.3
L-Lysine-HCl	1.6	0.86
DL-Methionine	3.7	3.09
NaCl	3.7	3.7
Choline-Cl	0.8	0.8
Vitamin premix^2	1	1
Mineral premix^3	1	1
Total	1,000	1,000
Calculated nutrient value
ME, kcal/kg	3,050	3,175
Crude protein, %	23	21
Calcium, %	1.05	0.9
Total Phosphorus, %	0.77	0.71
Available Phosphorus, %	0.5	0.45
Lysine, %	1.43	1.25
Methionine + Cystein, %	1.07	0.96
Analysed nutrition value
Crude protein^4, %	22.7	21.0

¹ The control group was fed the basal diet. The other groups were fed the basal diet supplemented with 0.5, 1, or 2% dry Phyllanthus emblica leaves and branches mixture (PE).

²Supplied per kg of diet: Vit A 15,000 U; Vit. D3 3000 U; Vit. E 30 mg; Vit. K 34 mg; Riboflavin 8 mg; Pyridoxine 5 mg; Vit. B12 25 µg; Ca-pantothenate 19 mg; Niacin 50 mg; Folic acid 1.5 mg; Biotin 60 µg.

³Supplied per kg of diet: Co (CoCO₃) 0.255 mg; Cu (CuSO₄˙5H₂O) 10.8 mg; Fe (FeSO_4˙H₂O) 90 mg; Zn (ZnO) 68.4 mg; Mn (MnSO₄˙H₂O) 90 mg; Se (Na₂SeO₃) 0.18 mg.

⁴ The analysed crude protein of starter diets (22.7%) was the average of control group (22.6%), 0.5% PE group (22.7%), 1% PE group (22.7%) and 2% PE group (22.9%); the analysed crude protein of finisher diets (21.0%) was the average of control group (21.0%), 0.5% PE group (20.9%), 1% PE group (20.8%) and 2% PE group (21.1%).

Table 2. Characteristics and performance data of the primers used for qPCR analysis.

Gene	Forward primer (from 5' to 3')	PCR product size (bp)	NCBI GenBank
	Reverse primer (from 5' to 3')
β-actin	CTGGCACCTAGCACAATGA	109	X00182.1
	ACATCTGCTGGAAGGTGGAC
HO-1	AGCTTCGCACAAGGAGTGTT	106	X56201.1
	GGAGAGGTGGTCAGCATGTC
NOX1	CAATGCAGCACTCCACTTTG	185	NM_001101830.1
	GACAAGATCTCCGCAAGACC
GST	AGTCGAAGCCTGATGCACTT	121	L15386.1
	TCTAGGCGTGGTTTCCTTTG
Nrf2	GGAAGAAGGTGCTTTTCGGAGC	171	NM_205117.1
	GGGCAAGGCAGATCTCTTCCAA
ROMO1	AGCCCAGCTGCTTCGACAGAGT	115	NM_001198821.1
	CGTCCTCTCATGCCGATCCTGA
GCLC	CAGCACCCAGACTACAAGCA	118	XM_419910.3
	CTACCCCCAACAGTTCTGGA
SOD1	ATTACCGGCTTGTCTGATGG	173	NM_205064.155
	CCTCCCTTTGCAGTCACATT

HO-1: haem oxygenase -1; NOX1: NADPH oxygenase 1; GST: glutathione S-transferase; Nrf2: nuclear factor (erythroid-derived 2) -like 2; ROMO1: reactive oxygen species modulator protein 1; GCLC: glutamate-cysteine ligase, catalytic subunit; SOD1: superoxide dismutase 1.

Table 3. Chemical composition and content of the bioactive compounds of Phyllanthus emblica leaves and branches mixture¹.

Items
Chemical composition
Dry matter (%)	92.1 ± 0.49
Crude ash (%)	2.98 ± 0.11
ADF^5 (%)	23.7 ± 0.71
NDF^6 (%)	34.8 ± 0.78
Crude protein (%)	10.7 ± 0.08
Ether extract (%)	1.2 ± 0.28
Bioactive compounds
Total Phenolics (mg of GAE^3/g DW^2)	95.5 ± 2.75
Total Flavonoids (mg of QE^4/g DW)	3.04 ± 0.06
Gallic acid (mg/g DW)	21.7 ± 0.46
Ellagic acid (mg/g DW)	13.6 ± 0.78
Rutin (mg/g DW)	3.16 ± 0.04
Quercetin (mg/g DW)	2.17 ± 0.08

¹Each value represents the mean of 3 replicates (n = 3).

²DW: Dry weight.

³GAE: Gallic acid equivalent.

⁴QE: Quercetin equivalent.

⁵ADF: Acid detergent fiber.

⁶NDF: Neutral detergent fiber.

Figure 1. Chelating capacity (a), reducing power (B), DPPH scavenging capacity (C), and inhibition of liposome oxidation (D) of Phyllanthus emblica leaves and branches mixture extracts (PEE). Vit C: Vitamin C, Ascorbic acid; BHT: Butylated hydroxytoluene. Values are mean ± SD.

Table 4. Trolox equivalent antioxidant capacity (TEAC) of Phyllanthus emblica leaves and branches mixture aqueous extracts, Butylated hydroxytoluene and ascorbic acid.

Treatments^1	Concentration (µg/mL)	trolox eq (µM trolox)
BHT	80	287.44 ± 2.95
	40	242.49 ± 1.44
	10	79.7 ± 1.02
VitC	60	291.36 ± 1.66
	50	257.71 ± 0.73
	20	82.44 ± 0.58
PEE	250	282.57 ± 3.53
	200	246.54 ± 1.05
	50	77.68 ± 1.21

¹Each value represents the mean of 3 replicates with 3 treatments (n = 3).

BHT: Butylated hydroxytoluene; VitC: ascorbic acid; PEE: Phyllanthus emblica leaves and branches mixture extracts.

Table 5. Effect of Phyllanthus emblica leaves and branches mixture on growth performance of broilers.

	Experimental diets				SEM	P value
Item	Control	0.5% PE	1% PE	2% PE
1-21 days
Body weight,g^1	820^ab	855^a	787^b	740^c	13.5	0.002
Feed consumption, g^2	1,101^a	1,047^ab	1,016^bc	969^c	18.0	0.005
Weight gain, g^1	772^ab	807^a	738^b	692^c	13.5	0.002
FCR^2	1.41^a	1.30^b	1.38^ab	1.40^a	0.03	0.028
22-35 days
Body weight,g	1,850^b	1,992^a	1,840^b	1,714^c	31.9	0.002
Feed consumption, g	1,776^a	1,769^a	1,713^ab	1,590^b	39.5	0.044
Weight gain, g	1,030^ab	1,137^a	1,053^ab	974^b	32.0	0.042
FCR	1.73^a	1.56^b	1.62^ab	1.64^ab	0.04	0.046
1-35 days
Feed consumption, g	2,877^a	2,816^a	2,729^a	2,559^b	43.4	0.004
Weight gain, g	1,802^b	1,943^a	1,791^b	1,666^c	33.0	0.002
FCR	1.60^a	1.45^c	1.52^b	1.54^ab	0.02	0.002

¹Results are provided as the means of four replicates (20 birds/replicate) in each control and treatment group (n = 4).

²FCR: Feed conversion rate. The results are provided as the means of eighty birds in each control and treatment group (n = 80).

PE: Phyllanthus emblica leaves and branches mixture.

SEM: standard error of the mean.

^a,b,c Means within the same rows without the same superscript letter are significantly different (p < 0.05).

Table 6. Effect of Phyllanthus emblica leaves and branches mixture supplemented in diet on lactic acid bacteria, coliform and Clostridium perfringens count in intestinal content of 35-day-old broilers1.

	Experimental diets				SEM	P value
Item	Control	0.5% PE	1% PE	2% PE
Lactic acid bacteria	Log10 cfu/g
Ileum	8.67	8.88	8.94	8.72	0.02	0.167
Caecum	11.7	11.8	11.7	11.8	0.01	0.904
Coliform	Log10 cfu/g
Ileum	7.37^a	6.15^b	6.32^b	6.26^b	0.14	0.003
Caecum	10.3^a	8.15^b	8.31^b	8.36^b	0.60	<0.0,001
Clostridium perfringens	Log10 cfu/g
Ileum	7.23^a	6.8^b	6.75^b	6.79^b	0.06	0.005
Caecum	10.8^a	9.92^b	9.89^b	9.93^b	0.15	0.037

¹ Results are provided as the means of four replicates (4 birds/replicate) in each control and treatment group (n = 4).

PE: Phyllanthus emblica leaves and branches mixture.

SEM: standard error of the mean.

^a,bMeans within the same rows without the same superscript letter are significantly different (p < 0.05).

Figure 2. Photomicrography of jejunum and ileum of 35d broiler fed with control and PE. (A) Control, jejunum (B) 0.5% PE, jejunum (C) 1% PE, jejunum (D) 2% PE, jejunum (E) Control, ileum (F) 0.5% PE, ileum (G) 1% PE, ileum (H) 2% PE, ileum. PE: Phyllanthus emblica leaves and branches mixture. Haematoxylin and eosin stain (40×) (method according to Tsai et al. (2021)).

Table 7. Effect of Phyllanthus emblica (PE) leaves and branches mixture supplemented in diet on intestinal morphology of 35-day-old broilers¹.

	Experimental diets				SEM	P value
Item	Control	0.5% PE	1% PE	2% PE
Jejunum
Villus height (μm)	960^c	1,114^a	1,021^b	1,019^b	11.2	0.0,002
Crypt depth (μm)	256^a	196^b	196^b	212^b	4.98	<0.0,001
Villus height/Crypt depth	3.92^c	5.63^a	4.51^b	4.41^b	0.07	<0.0,001
Ileum
Villus height (μm)	882	885	882	846	10.6	0.210
Crypt depth (μm)	239^a	157^c	187^b	194^b	5.31	<0.0,001
Villus height/Crypt depth	3.63^c	5.49^a	5.31^a	4.17^b	0.07	<0.0,001

¹ Results are provided as the means of 15 spots corresponding to four birds for the control group (corn-soybean meal diet) and 0.5% PE, 1% PE and 2% PE (n = 4).

PE: Phyllanthus emblica leaves and branches mixture.

SEM: standard error of the mean.

^a,b,cMeans within the same rows without the same superscript letter are significantly different (p < 0.05).

Table 8. Effects of Phyllanthus emblica (PE) leaves and branches mixture supplemented in diets on the serum antioxidant enzymes activities and MDA levels of 35-day-old broilers¹.

	Experimental diets				SEM	P value
Item	Control	0.5% PE	1% PE	2% PE
MDA^2 (µM)	20.0^a	14.5^b	14.8^b	14.4^b	1.05	0.008
SOD^2 (U/mL)	5.04^b	7.08^a	7.03^a	6.16^a	0.21	0.003
CAT^2 (U/mL)	53.0^b	64.0^a	61.7^a	60.4^a	1.54	0.007
GSH-Px^2 (U/mL)	718^b	793^a	775^a	769^a	10.5	0.041

¹ Results are provided as the means of four replicates (2 birds/replicate) in each control and treatment group (n = 4).

² MDA, SOD, CAT and GPx represent the malondialdehyde, superoxide dismutase, catalase and Glutathione peroxidase, respectively.

respectively.

PE: Phyllanthus emblica leaves and branches mixture.

SEM: standard error of the mean.

^a,bMeans within the same rows without the same superscript letter are significantly different (p < 0.05).

Figure 3. Effects of Phyllanthus emblica leaves and branches mixture (PE) supplemented in diets on mRNA expression levels of the antioxidant-regulated genes of 35-day-old broilers.

Tsai CF, Lin LJ, WAng CH, Tsai CS, Chang SC, Lee TT. 2021. Assessment of intestinal immunity and permeability of broilers on partial replacement diets of two-stage fermented soybean meal by Bacillus velezensis and Lactobacillus brevis ATCC 367. Animals. 11(8):2336. doi: 10.3390/ani11082336.

 Web of Science ®Google Scholar

Data availability statement

The data presented in this study are available on request from the corresponding author upon reasonable request