Effects of rutin on laying performance, egg quality, serum biochemistry, antioxidant capacity and immunity in laying hens fed a diet containing stored soybean meal

Figures & data

Table 1. Composition and nutrient level of basal diet (as fed basis unless otherwise stated).

Item	Content
Ingredient (%)
Corn	64
Soybean meal	24
Limestone	9
Premix^a	3
Calculated nutrient levels
Apparent metabolisable energy (MJ/kg)	11.04
Crude protein (%)	16.16
Lysine (%)	0.80
Methionine + cystine (%)	0.62
Methionine (%)	0.34
Calcium (%)	3.6
Total phosphorus (%)	0.56
Available phosphorus (%)	0.37

^aSupplied per kg of diet: Vitamin A, 10,000 IU; vitamin D3, 3000 IU; vitamin E, 30 IU; vitamin K3, 1 mg; vitamin B1, 1 mg; vitamin B2, 6 mg; vitamin B6, 3 mg; pantothenic acid, 10 mg; vitamin B12, 0.02 mg; nicotinamide, 40 mg; folic acid, 0.3 mg; biotin, 0.1 mg; choline chloride, 500 mg; Fe (ferrous sulfate), 80 mg; Cu (copper sulfate), 8 mg; Mn (manganese sulfate), 100 mg; Zn (zinc oxide), 65 mg; I (calcium iodate), 0.8 mg; Se (sodium selenite), 0.3 mg; calcium, 3.6 g; phosphorus, 2.4 g; methionine, 1 g; sodium chloride, 3 g.

Table 2. Sequences for real-time PCR primers.

Genes^a	Gene Bank ID		Primer Sequence (5′’-3′’)	Product length (bp)
GPX1	NM_001277853.1	F	CGCTACAGCCGCCACTT	287
		R	TTCGGAGAATCCCACAACG
GSTT1	NM_205365.1	F	GACGGAGACTTCACCCTAGCAGA	87
		R	TGATGGGTACCAGTGGTCAGGA
SOD1	NM_205064.1	F	TTGTCTGATGGAGATCATGGCTTC	98
		R	TGCTTGCCTTCAGGATTAAAGTGAG
SOD2	NM_204211.1	F	CAGATAGCAGCCTGTGCAAATCA	86
		R	GCATGTTCCCATACATCGATTCC
β-actin	NM_205518	F	TGCTGTGTTCCCATCTATCG	150
		R	TTGGTGACAATACCGTGTTCA

^aGPX1: glutathione peroxidase 1; GSTT1: glutathione S-transferase theta 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2.

Table 3. Effect of rutin on laying performance of laying hens fed a diet containing stored soybean meal.

Treatment^a		Items^b
SBM	Rutin (mg/kg)	Laying rate (%)	Average egg weight (g)	ADFI (g)	Egg mass (g)	Feed-to-egg ratio
FSM	0	87.33	60.27	121.01	52.62	2.30
	500	89.84	61.10	123.06	54.86	2.25
RTSM	0	88.67	60.72	122.58	53.85	2.27
	500	91.56	59.98	121.85	54.92	2.22
SEM^c		0.82	0.21	0.59	0.49	0.02
Main effect
SBM
FSM		88.58	60.68	122.04	53.74	2.28
RTSM		90.11	60.35	122.21	54.38	2.25
Rutin
0		88.00	60.50	121.79	53.23	2.29
500		90.70	60.54	122.45	54.89	2.23
p-Value^d
SBM		0.353	0.407	0.941	0.509	0.416
Rutin		0.107	0.924	0.452	0.096	0.146
SBM × Rutin		0.909	0.061	0.364	0.545	0.995

^aSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at –20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^bADFI: average daily feed intake.

^cSEM: standard errors of mean (n = 8).

^dp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 4. Effect of rutin on egg quality of laying hens fed a diet containing stored soybean meal at the end of fourth week.

Treatment^c		Items
SBM	Rutin (mg/kg)	Eggshell strength (kg/cm2)	Eggshell thickness (μm)	Albumen height (mm)	Yolk colour	Haugh unit	Egg yolk ratio (%)
FSM	0	4.46	331.11	7.73	6.22	88.19	26.59
	500	4.62	347.96	8.93	8.94	93.79	28.23
RTSM	0	4.45	318.29	8.49	6.28	91.81	27.08
	500	4.57	356.17	8.88	9.24	93.56	27.48
SEM^d		0.09	3.91	0.16	0.28	1.03	0.28
Main effect
SBM
FSM		4.54	339.53	8.33	7.58	90.99	27.41
RTSM		4.51	337.23	8.68	7.76	92.68	27.28
Rutin
0		4.46	324.70^b	8.11^b	6.25^b	90.00	26.83
500		4.60	352.06^a	8.90^a	9.09^a	93.68	27.85
p-Value^e
SBM		0.876	0.708	0.230	0.893	0.402	0.782
Rutin		0.451	< 0.001	0.010	< 0.001	0.075	0.074
SBM × Rutin		0.914	0.095	0.172	0.126	0.343	0.255

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dSEM: standard errors of mean (n=8).

^ep-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 5. Effect of rutin on egg quality of laying hens fed a diet containing stored soybean meal at the end of eighth week.

Treatment^c		Items
SBM	Rutin (mg/kg)	Eggshell strength (kg/cm^2)	Eggshell thickness (μm)	Albumen height (mm)	Yolk colour	Haugh unit	Egg yolk ratio (%)
FSM	0	4.79	323.94	9.00	6.00	91.29	26.38
	500	5.28	343.73	8.98	5.38	95.09	25.76
RTSM	0	4.63	324.56	8.29	4.91	89.41	24.74
	500	5.11	347.44	8.11	5.21	89.53	27.19
SEM^d		0.09	3.49	0.13	0.19	1.49	0.36
Main effect
SBM		5.03	333.83	8.99^a	5.69	93.19	26.03
FSM		4.87	336.00	8.20^b	5.06	89.47	25.85
RTSM
Rutin
0		4.71^b	324.25^b	8.65	5.46	90.35	25.51
500		5.20^a	345.58^a	8.54	5.30	92.31	26.37
p-Value^e
SBM		0.359	0.726	0.002	0.107	0.226	0.881
Rutin		0.009	0.002	0.658	0.676	0.520	0.182
SBM × Rutin		0.991	0802	0.732	0.233	0.546	0.030

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dSEM: standard errors of mean (n=8).

^ep-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 6. Effect of rutin on serum biochemical indexes of laying hens fed a diet containing stored soybean meal.

Treatment^d		Items^e
SBM	Rutin (mg/kg)	GLU (mmol/L)	TG (mmol/L)	TC (mmol/L)	TP (g/L)	ALB (g/L)	GLOB (g/L)	UN (mmol/L)	LDL (mmol/L)	HDL (mmol/L)
FSM	0	11.47	16.04	3.21	54.13	16.33	37.80	4.81^c	1.11	0.51
	500	10.50	15.28	3.32	53.75	16.68	37.08	8.90^a	1.27	0.60
RTSM	0	12.01	13.19	2.89	51.43	15.51	35.92	6.60^b	1.05	0.53
	500	11.44	13.09	3.31	54.65	16.03	38.63	6.91^b	1.40	0.69
SEM^f		0.27	1.33	0.15	1.13	0.22	1.12	0.31	0.09	0.06
Main effect
SBM
FSM		10.98	15.66	3.26	53.94	16.50	37.44	6.86	1.19	0.55
RTSM		11.72	13.14	3.10	53.04	15.77	37.27	6.76	1.22	0.61
Rutin
0		11.74	14.62	3.05	52.78	15.92	36.86	5.70^b	1.08	0.52
500		10.97	14.18	3.32	54.20	16.35	37.85	7.91^a	1.33	0.64
p-Value^g
SBM		0.179	0.369	0.604	0.703	0.102	0.945	0.775	0.854	0.623
Rutin		0.163	0.876	0.397	0.548	0.333	0.674	<0.001	0.174	0.288
SBM × Rutin		0.710	0.905	0.625	0.448	0.846	0.468	<0.001	0.259	0.768

^a,b,cMeans with different superscripts within a column differ significantly (p < 0.05).

^dSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^eGLU: glucose; TG: triglyceride; TC: total cholesterol; TP: total protein; ALB: albumin; GLOB: globulin; UN: urea nitrogen; LDL: low-density lipoprotein; HDL: high-density lipoprotein.

^fSEM: standard errors of mean (n=8).

^gp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 7. Effect of rutin on immunoglobulins levels of laying hens fed a diet containing stored soybean meal.

Treatment^d		Items^e
SBM	Rutin (mg/kg)	IgA (mg/mL)	IgG (mg/mL)	IgM (mg/mL)
FSM	0	2.58	3.35	4.90^a
	500	2.11	2.94	3.30^c
RTSM	0	2.39	3.17	4.20^a,b
	500	2.28	3.11	3.92^b,c
SEM^f		0.08	0.09	0.14
Main effect
SBM
FSM		2.35	3.14	4.10
RTSM		2.33	3.14	4.06
Rutin
0		2.48	3.26	4.55^a
500		2.20	3.03	3.61^b
p-Value^g
SBM		0.925	0.989	0.849
Rutin		0.068	0.212	< 0.001
SBM × Rutin		0.234	0.355	0.004

^a,b,cMeans with different superscripts within a column differ significantly (p < 0.05).

^dSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^eIgA: immunoglobulin A; IgG: immunoglobulin G; IgM: immunoglobulin M.

^fSEM: standard errors of mean (n=8).

^gp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 8. Effect of rutin on antioxidant capacity in serum of laying hens fed a diet containing stored soybean meal.

Treatment^c		Items^d
SBM	Rutin (mg/kg)	MDA (nmol/mL)	SOD (U/mL)	T-AOC (U/mL)	GSH-Px (U/mL)
FSM	0	3.41	298.70	2.37	731.75
	500	2.85	402.14	2.91	770.52
RTSM	0	2.57	340.60	1.87	790.04
	500	3.30	354.53	3.91	718.95
SEM^e		0.19	15.88	0.23	21.25
Main effect
SBM
FSM		3.13	350.42	2.64	751.14
RTSM		2.94	347.57	2.89	754.50
Rutin
0		2.99	319.65	2.12^b	760.90
500		3.08	378.33	3.41^a	744.74
p-Value^f
SBM		0.610	0.926	0.525	0.939
Rutin		0.828	0.063	0.003	0.712
SBM × Rutin		0.102	0.152	0.069	0.216

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dMDA: malondialdehyde; T-SOD: total superoxide dismutase; T-AOC: total antioxidant capacity; GSH-Px: glutathione peroxidase.

^eSEM: standard errors of mean (n=8).

^fp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 9. Effect of rutin on antioxidant capacity in the liver of laying hens fed a diet containing stored soybean meal.

Treatment^c		Items^d
SBM	Rutin (mg/kg)	MDA (nmol/mg prot.)	SOD (U/mg prot.)	T-AOC (U/mg prot.)	GSH-Px (U/mg prot.)
FSM	0	0.54	939.93	0.51	53.52
	500	0.54	897.04	0.92	110.80
RTSM	0	0.62	988.28	0.47	91.11
	500	0.71	851.24	1.13	104.15
SEM^e		0.03	35.27	0.06	9.28
Main effect
SBM
FSM		0.54	918.49	0.71	82.16
RTSM		0.66	919.76	0.80	97.63
Rutin
0		0.58	964.11	0.49^b	72.31
500		0.62	874.14	1.03^a	107.47
p-Value^f
SBM		0.074	0.986	0.288	0.388
Rutin		0.587	0.220	<0.001	0.056
SBM × Rutin		0.527	0.517	0.126	0.220

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dMDA: malondialdehyde; T-SOD: total superoxide dismutase; T-AOC: total antioxidant capacity; GSH-Px: glutathione peroxidase.

^eSEM: standard errors of mean (n=8).

^fp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 10. Effect of rutin on antioxidant-related genes expression in the liver of laying hens fed a diet containing stored soybean meal.

Treatment^a		Items^b
SBM	Rutin (mg/kg)	GPX1	GSTT1	SOD1	SOD2
FSM	0	1.00	1.00	1.00	1.00
	500	1.32	1.22	1.43	1.63
RTSM	0	1.07	1.10	1.10	1.47
	500	1.20	0.80	1.01	1.24
SEM^c		0.12	0.08	0.09	0.16
Main effect
SBM
FSM		1.16	1.11	1.21	1.32
RTSM		1.13	0.95	1.05	1.36
Rutin
0		1.03	1.05	1.05	1.24
500		1.26	1.01	1.22	1.44
p-Value^d
SBM		0.904	0.328	0.353	0.908
Rutin		0.378	0.793	0.325	0.546
SBM × Rutin		0.706	0.109	0.138	0.204

^aSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at –20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^bGPX1: glutathione peroxidase 1; GSTT1: glutathione S-transferase theta 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2.

^cSEM: standard errors of mean (n = 8).

^dp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Data availability statement

The data that support the findings of this study are available from the corresponding author, Yanmin Zhou, upon reasonable request.