Polymorphism and promoter methylation-regulated mRNA expression of IFI6 gene affect meat quality in pigs

Figures & data

Table 1. Physicochemical traits of the Longissimus thoracis et lumborum of pig fatteners.

Traits	Mean ± SE (n = 300)
Drip loss (%)	2.84 ± 0.08
Thawing loss (%)	4.16 ± 0.13
Cooking loss (%)	30.16 ± 0.24
pH45min	6.64 ± 0.02
pH24h	5.86 ± 0.01
Shear force (N)	60.21 ± 0.36
Lightness (L*)	43.81 ± 0.62

^apH45min, pH24h value in the Longissimus thoracis et lumborum (LTL) 45 min and 24 h post-mortem, respectively.

Table 2. List of primers for genotyping, methylation and qRT-PCR.

Gene	Primer sequence	Tm (°C)m	Product	Polymorphism	Enzyme	Method	References
IFI6	Fw: 5′-AAGGCGGTATCGCTCTTCTT-3′	58.7	562 bp	g370A > G	HphI	genotyping	Kayan et al. (2011)
	Rw: 5′-AGGCAGCCACAGAGTTGG-3′
IFI6	Fw: 5′-GGGTTTTGGGTTTAGTTTAGAGTAT-3′	60				methylation
	Rw(biotin): 5′-CAAATACCCCAAAATCCTTACCTA-3′
	Fw: 5′-TTTATGAATTTATTGTTAAA-3′
	Rw(biotin): 5′-GGGAATTAGGTTTTTTTTTAG-3′
IFI6	Fw: 5′-AAGGCGGTATCGCTCTTCTT-3′	60				qRT-PCR	Kayan et al. (2011)
	Rw: 5′- TTCTGTTTTGCTTGGTTTTGTTT -3′
GAPDH	Fw: 5′-ACCCAGAAGACTGTGGATGG-3′	60				qRT-PCR	Kayan et al. (2011)
	Fw: 5′- ACGCCTGCTTCACCACCTTC -3′

Table 3. Genotype and allele frequencies of IFI6 gene.

Gene	Genotype	Commercial pigs (n = 300)	Allele	Commercial pigs (n = 300)
IFI6	AA	0.23	A	0.49
	AG	0.52	G	0.51
	GG	0.25

Table 4. Least square means (LSM) and standard errors (SE) for meat quality traits across genotype of IFI6 gene.

Traits	Genotype (Lsmean ± SE)^1			p-value	Effect (mean ± SE)
	AA	AG	GG		Additive	Dominance
Drip loss (%)	2.850 ± 0.160	2.940 ± 0.100	2.790 ± 0.160	0.742	0.030 ± 0.120	−0.110 ± 0.150
Thawing loss (%)	4.160 ± 0.230	4.200 ± 0.140	4.380 ± 0.230	0.763	−0.110 ± 0.170	0.070 ± 0.220
Cooking loss (%)	30.270 ± 0.140	30.010 ± 0.090	30.220 ± 0.140	0.202	0.030 ± 0.100	0.240 ± 0.130
pH45min	6.660 ± 0.010	6.600 ± 0.020	6.650 ± 0.030	0.213	−0.010 ± 0.020	0.050 ± 0.030
pH24h	5.800 ± 0.020^a	5.880 ± 0.010^b	5.910 ± 0.020^b	0.003	−0.050 ± 0.020***	−0.020 ± 0.020
Shear force	59.040 ± 0.040	59.330 ± 0.030	59.130 ± 0.040	0.772	−0.010 ± 0.030	−0.030 ± 0.040
Lightness (L*)	43.940 ± 0.180	43.870 ± 0.110	43.990 ± 0.180	0.844	−0.030 ± 0.130	0.090 ± 0.170

^a,bDifferent letters denoting significant difference between groups. ***p < .001.

Figure 1. Methylation sites in the promoter region of IFI6 gene. The IFI6 promoter region was predicted for the CpG island by using the MethPrimer program. There are four CpG islands identified in the IFI6 gene.

Figure 2. Methylation percentage of the CpG islands in the promoter of IFI6 gene. The methylation percentages were determined by pyrosequencing between low and high meat pH groups. The bars represent the mean ± SE. * indicates the difference of promoter methylation percentage was statistically significant (p < 0.05) between groups.

Figure 3. Expression level of IFI6 gene between divergent phenotypic groups. qRT-PCR analysis of IFI6 gene expression from (a) low pH24h vs high pH24h and (b) low vs high drip loss groups (n = 5 per group) in pigs. GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) was used as a reference gene for the normalisation of transcripts. The bars represent the mean ± SE. *p < 0.05 and **p < 0.01 denote statistically significant difference.

Figure 4. Histological features of muscle from divergent phenotypic groups. The samples were collected at approx. 45 min after carcase bleeding or post-mortem, formalin fixed, stained with H&E, and studied under microscope (10×).

Kayan A, Uddin MJ, Cinar MU, Grosse-Brinkhaus C, Phatsara C, Wimmers K, Ponsuksili S, Tesfaye D, Looft C, Juengst H, et al. 2011. Investigation on interferon alpha-inducible protein 6 (IFI6) gene as a candidate for meat and carcass quality in pig. Meat Sci. 88(4):755–760. doi: 10.1016/j.meatsci.2011.03.009.

 PubMed Web of Science ®Google Scholar

Data availability statement

The data presented in this study are available on request from the corresponding author upon reasonable request.