The ribosome-associated complex antagonizes prion formation in yeast

Figures & data

Figure 1. Frequency of induced and spontaneous [psi⁻] to [PSI⁺] conversion for cells lacking RAC function compared with wildtype cells. (A) Induced [psi⁻] to [PSI⁺] conversion was measured following transient overexpression of the Sup35 N and M domains for Δzuo1 and wildtype strains containing the ade1–14 reporter. Cells were transformed with a plasmid encoding Sup35NM driven by the GAL1 promoter. Following growth in medium containing raffinose cultures were diluted into medium containing galactose (to induce expression), grown, then diluted and plated on YEPD (to determine total numbers of cells) and synthetic medium lacking adenine (to determine the number of Ade⁺ cells). Percentage Ade⁺ was calculated by dividing the number of Ade⁺ cells by the total number of cells and expressing as a percentage. In each case, a subset of Ade⁺ colonies was tested for curability to [psi⁻] by guanidine hydrochloride (GuHCl) to confirm that the vast majority of Ade⁺ colonies were [PSI⁺]. Error bars represent 95% confidence intervals. **** p < 0.0001 (2-proportion z-test). (B) Spontaneous prion formation was measured in cells with both the ade1–14 and ura3–14 nonsense suppression reporters. Cells that were [psi⁻] were plated to obtain single colonies, which were excised from the plate and resuspended in sterile H₂O. A small volume was diluted and plated on YEPD to determine total numbers of cells, while the remainder of each resuspended colony was plated on synthetic medium lacking adenine and uracil and incubated for 14 d to determine the number of [PSI⁺] cells. Only colonies that were curable to [psi⁻] by GuHCl were counted as [PSI⁺]. Conversion rates were calculated by fluctuation analysis^39,41 with error bars representing the 95% confidence intervals (n=10). (C) Relative abundance of Ssa1/2 (Ssa), Ssb1/2 (Ssb), Hsp104, Sis1 and Ydj1 in wildtype and Δzuo1 strains expressing each chaperone as a carboxyl-terminal GFP fusion from its endogenous promoter and natural chromosomal location. Median GFP fluorescence intensity (50000 cells per strain) was assessed by flow cytometry and normalized to fluorescence intensities from wildtype or Δzuo1 strains expressing GFP fused to Glyceraldehyde-3-phosphate dehydrogenase to account for variation due to intrinsic differences between the wildtype or Δzuo1 strains that may systematically influence fluorescence intensity. Error bars represent coefficient of variation.

Figure 2. Loss of RAC function bypasses the [PIN⁺] requirement in de novo [PSI⁺] formation. (A) Rates of spontaneous prion formation in wildtype and Δzuo1 strains that were cured to [rnq⁻] by treatment with GuHCl. Prion formation rates and 95% confidence intervals were calculated as for Figure 1B. (B) The aggregation state of Rnq1 was assessed in cells with (top panels) and without (bottom panels) RAC function in [RNQ⁺] cells (left), GuHCl−treated cells (center), and Δrnq1 cells (right) by expression of Rnq1-GFP from the inducible Cup1 promoter followed by confocal microscopy. Strains transformed with p316 Cup1pr-Rnq1-GFP were diluted into synthetic medium lacking uracil and supplemented with CuSO₄ (25 µM) and incubated at 30°C for 90 minutes prior to imaging. (C) Rates of spontaneous prion formation in Δrnq1 and Δrnq1 Δzuo1 strains that were cured to [pin⁻] by treatment with GuHCl. Prion formation rates and 95% confidence intervals were calculated as for Figure 1B.

Figure 3. The ability of Zuo1 to associate with ribosomes and stimulate Ssb is required for suppression of prion formation. (A) Wildtype Zuo1, a mutant lacking the J domain required for Ssb ATPase activation (zuo1Δ111–165), and a mutant lacking the charged region required for ribosome association (zuo1Δ284–363) were examined for their ability to block prion formation in vivo. (B) Frequency of induced [psi⁻] to [PSI⁺] conversion following transient over-expression of the Sup35 N and M domains for Δzuo1 and wildtype strains ectopically expressing different Zuo1 constructs. Percentage Ade⁺ was calculated as described for Figure 1A. Error bars represent 95% confidence intervals. **** p < 0.0001 (2-proportion z-test).

Figure 4. Expression of the glutamine/asparagine-rich proteins 62Q or Sup35NM has little effect on wildtype cells but substantially inhibits the growth of Δzuo1 cells. (A) Schematic of the proteins that were expressed as GFP fusions driven by the inducible Cup1 promoter. (B) Overexpression of 62Q and Sup35NM from the Cup1 promoter on multicopy plasmids reduces the growth of Δzuo1 cells regardless of the [PSI⁺] prion status of the cell. Over-expression of Rnq1, which has a C-terminal prion domain, from the Cup1 promoter on a centromeric plasmid has little effect on the growth of Δzuo1 cells. Error bars represent the standard error of the mean (n = 25−50).

Figure 5. Overexpression of Sup35NM is lethal in [psi⁻] cells lacking both Rnq1 and Zuo1, but not in [psi⁻] cells lacking Rnq1 only nor in [psi⁻][rnq⁻] cells lacking Zuo1 only. Sup35NM with a C-terminal GFP fusion was expressed from the inducible Gal1 promoter on a high copy plasmid (pRS426 Gal1pr-Sup35NM-GFP) by plating cells onto medium lacking uracil and supplemented with 2% galactose (or with 2% glucose to repress expression). The [PSI⁺] prion partially restores growth in Δrnq1 Δzuo1 cells.

Figure 6. A model for the function of the RAC in antagonizing prion formation. (Left panel) RAC-mediated Ssb chaperoning of nascent Sup35 minimizes its co-translational conversion into non-native conformations, including toxic misfolded species and [PSI⁺] prion conformations. (Center panel) In the absence of RAC function, the N-terminal prion domain of Sup35 is more vulnerable to misfolding. [PIN⁺] factors, such as the [RNQ⁺] prion, can serve as templates to cross-seed Sup35 folding into [PSI⁺] prion conformations and thereby reduce the propensity of Sup35 to adopt more toxic conformations. (Right panel) In the absence of RAC function and without [PIN⁺] factors, Sup35 is free to misfold into a wide spectrum of conformations, including prion forms and toxic misfolded forms.

Table 1. Primers used in this study

Primer	Sequence (5′→3′)
P1	CATTAAAAGAACGTACATATAGCGATACAAACGTATAGCAAAGATCTGAAGGTCGACGGATCCCCGGGTT
P2	TATATAAACAAATACGTAAACAAAGGATAGAAGGCGAACTGAATCATCGTTCGATGAATTCGAGCTCGTT
P3	GATAGCGGTTCCATTGTCGT
P4	CTGCAGCGAGGAGCCGTAAT
P5	CCTTGGGAATTGTTACCTGAC
P6	GCTACTCGAGGGATGGACGCAAAGAAGTTTAATAATC
P7	GCTAGGATCCGTTTTTTCTCCTTGACGTTAAAGTATAG
P8	GGTAGGTAGCGGCCGCAAATCGTAGCGCGATGAGAC
P9	GCTAGGATCCCATACCGCCAAAATTTCCAA
P10	CATCGGCAACAAAATCACATGATCTGAAACGCAACTTAGACAAACCC
P11	GGGTTTGTCTAAGTTGCGTTTCAGATCATGTGATTTTGTTGCCGATG
P12	GCATCACCAAAGTAGTCAGCTTCATCTTCACTGACAGCTCTTTCAAC
P13	GTTGAAAGAGCTGTCAGTGAAGATGAAGCTGACTACTTTGGTGATGC