Genetic effects of PRNP gene insertion/deletion (indel) on phenotypic traits in sheep

Figures & data

Table 1. PCR primer sequences of the sheep PRNP for applification.

Locus	Primer sequences (5′–3′)	Tm(^oC)	Product size (bp)	Region	Notes
I2-15bp	F1: TTGTACCAGTCTTTGTCCTTGCA	60.1	182/197	Intron2	for indel detecting
	R1: TCCTCTGTCCATTAGATTTCCCA	60.4
3’UTR-7bp	F2: GGGAATAGCATTTCTGCCAAGTC	62.1	242/249	3’UTR
	R2: AAGATGTCCTCTGCCCATAAGTC	59.3
I2-19bp	F3: GGCCAACCCAACTTCTAAATTAC	59.4	140/159	Intron2
	R3: AAACAAAGGGGAAACAAAGTCAT	59.2
I1-7bp	F4: TTTCGTCATCGTCCTTTTGTCC	61.6	228/235	Intron1
	R4: TCTTCCATTGCAGGTAAGTTCC	58.7
I2-12bp	F5: TGATGCTCTCACTTGAATGGCTC	61.8	258/270	Intron2
	R5: GATGGTGGTGTAATCTGGGACTG	60.8
I2-28bp	F6: TTCCAACATAAATGACACAAATTCC	60.3	336/308	Intron2
	R6: ACTGTAGCCTTTCAGTCTCCTCTGA	60.9

Figure 1. Gene structure and primer design diagram of sheep PRNP.

Figure 2. Amplificationdiagram (a), electrophoresis pattern (b) and sequence diagram of the Intron-2-insertion-15 bp (c₁) and 3’UTR-insertion-7 bp (c₂) indel variants of sheep PRNP gene.

Figure 3. Electrophoresis pattern and sequence diagram of Intron-2-insertion-19 bp indel variants of sheep PRNP gene.

Figure 4. Electrophoresis pattern and sequence diagram of Intron-1-insertion-7 bp indel variants of the PRNP gene in sheep (The insertion sample was genotyped as ID.).

Table 2. Diversity parameter for indel loci of sheep PRNP gene.

		Sizes	Genotypic frequencies			Allelic frequencies		^aHWE	Population parameters
Locus	Breeds	N	DD	ID	II	D	I	P values	Ho	He	Ne	PIC
I2-15 bp	LFTS	61	0.000	0.672	0.328	0.336	0.664	P < 0.05	0.554	0.446	1.806	0.347
	STHS	195	0.031	0.328	0.641	0.195	0.805	P > 0.05	0.686	0.314	1.457	0.265
	TS	165	0.000	0.364	0.636	0.182	0.818	P < 0.05	0.703	0.297	1.424	0.253
	HS	201	0.030	0.340	0.630	0.200	0.800	P > 0.05	0.680	0.320	1.471	0.269
	Sartuul	146	0.007	0.212	0.780	0.113	0.887	P > 0.05	0.799	0.201	1.251	0.180
3’UTR-7 bp	LFTS	61	0.525	0.475	0.000	0.762	0.238	P < 0.05	0.638	0.362	1.568	0.297
	STHS	195	0.810	0.190	0.000	0.905	0.095	P > 0.05	0.828	0.172	1.207	0.157
	TS	165	0.636	0.364	0.000	0.818	0.182	P < 0.05	0.703	0.297	1.424	0.253
	HS	201	0.920	0.080	0.000	0.960	0.040	P > 0.05	0.923	0.077	1.083	0.074
	Sartuul	145	0.841	0.159	0.000	0.921	0.079	P > 0.05	0.854	0.146	1.171	0.135
I2-19 bp	LFTS	47	0.319	0.532	0.149	0.585	0.415	P > 0.05	0.514	0.486	1.944	0.368
	STHS	190	0.505	0.300	0.195	0.655	0.345	P < 0.05	0.548	0.452	1.824	0.350
	TS	156	0.462	0.480	0.058	0.702	0.298	P > 0.05	0.582	0.418	1.720	0.331
	HS	155	0.523	0.393	0.084	0.719	0.281	P > 0.05	0.596	0.404	1.677	0.322
	Sartuul	145	0.055	0.869	0.076	0.490	0.510	P < 0.05	0.500	0.500	1.999	0.375
I1-7 bp	LFTS	61	0.984	0.016	0.000	0.992	0.008	P > 0.05	0.984	0.016	1.017	0.016
	STHS	188	0.755	0.245	0.000	0.878	0.122	P > 0.05	0.785	0.215	1.274	0.192
	TS	158	0.677	0.241	0.082	0.798	0.202	P < 0.05	0.677	0.323	1.477	0.271
	HS	197	0.944	0.056	0.000	0.972	0.028	P > 0.05	0.946	0.054	1.057	0.053
	Sartuul	144	0.014	0.000	0.986	0.014	0.986	P < 0.05	0.973	0.027	1.028	0.027

Note: HWE, Hardy-Weinberg equilibrium; Ho, homozygosity; He, heterozygosity; Ne, effective allele numbers; PIC, Polymorphism information content

Table 3. Genetic analysis of linkage equilibrium of four pair alleles (D' and r²) on five sheep breeds.

Breeds	D'test				r^2 test
LFTS		3’UTR–7bp	I2–19bp	I1–7bp		3’UTR–7bp	I2–19bp	I1–7bp
	I2–15bp	0.406	1.000	1.000	I2–15bp	0.109	0.629	0.004
	3’UTR–7bp	—	0.733	1.000	3’UTR–7bp	—	0.131	0.003
	I2–19bp	—	—	1.000	I2–19bp	—	—	0.008
STHS		3’UTR–7bp	I2–19bp	I1–7bp		3’UTR–7bp	I2–19bp	I1–7bp
	I2–15bp	0.475	0.831	0.038	I2–15bp	0.098	0.309	0.001
	3’UTR–7bp	—	0.790	0.131	3’UTR–7bp	—	0.123	0.013
	I2–19bp	—	—	0.149	I2–19bp	—	—	0.006
TS		3’UTR–7bp	I2–19bp	I1–7bp		3’UTR–7bp	I2–19bp	I1–7bp
	I2–15bp	0.783	0.971	0.249	I2–15bp	0.601	0.496	0.004
	3’UTR–7bp	—	0.971	0.225	3’UTR–7bp	—	0.507	0.003
	I2–19bp	—	—	0.087	I2–19bp	—	—	0.004
HS		3’UTR–7bp	I2–19bp	I1–7bp		3’UTR–7bp	I2–19bp	I1–7bp
	I2–15bp	0.714	0.585	0.822	I2–15bp	0.085	0.233	0.005
	3’UTR–7bp	—	0.445	1.000	3’UTR–7bp	—	0.019	0.001
	I2–19bp	—	—	0.154	I2–19bp	—	—	0.002
SS		3’UTR–7bp	I2–19bp	I1–7bp		3’UTR–7bp	I2–19bp	I1–7bp
	I2–15bp	0.362	0.831	1.000	I2–15bp	0.091	0.082	0.002
	3’UTR–7bp	—	0.997	1.000	3’UTR–7bp	—	0.082	0.001
	I2–19bp	—	—	0.020	I2–19bp	—	—	0.000

Figure 5. Genetic analysis of linkage equilibrium on different population of four pair alleles in sheep PRNP gene: (a) Lanzhou Fat-Tail sheep, (b) Small Tail Han sheep, (c) Tong sheep, (d) Hu sheep, (e) Sartuul sheep. Loci chosen for hap-analysis: loci1: I2-15 bp, loci2: 3’UTR-7 bp, loci3: I2-19 bp, loci4: I1-7 bp.

Figure 6. Haplotype frequency of four mutation loci within the sheep PRNP gene in different breeds: (a) Small Tail Han sheep, (b) Tong sheep, (c) Lanzhou Fat-Tail sheep, (d) Hu sheep, (e) Sartuul sheep Note: Abscissa represents the haplotype and ordinate means the frequency. Loci chosen for hap-analysis: loci1: I2-15bp, loci2: 3’UTR-7bp, loci3: I2-19bp, loci4: I1-7bp (All those frequency < 0 will be ignored in analysis.).

Table 4. Relationship between the different indel locus of PRNP gene and growth related traits in different breeds (LSM^a ± SE).

				Observed genotypes (LSM^a ± SE)
Loci	Breeds	Sizes	Growth traits	II	ID	DD	p values
I2-15 bp	STHS (ram)	98	ChW(cm)	^c18.34 ± 0.44	^c18.46 ± 0.39	^a20.00 ± 0.00	0.001
	STHS (ewe)	97	ChC(cm)	^a,b75.86 ± 1.74	^b70.00 ± 1.76	^a83.80 ± 1.84	0.045
			CaC(cm)	^a,b6.84 ± 0.10	^a7.12 ± 0.15	^b6.17 ± 0.17	0.014
			CaCI	11.02 ± 0.20	11.39 ± 0.27	9.40 ± 0.51	0.050
	TS (ram)	25	BLI	106.45 ± 1.40	111.63 ± 1.63	—	0.034
3’UTR-7 bp	STHS (ram)	98	ChCI	—	108.12 ± 2.62	113.13 ± 0.88	0.033
	TS (ewe)	55	WL(cm)	—	5.14 ± 0.41	6.36 ± 0.31	0.022
	HS (ewe)	201	ChC(cm)	—	73.59 ± 1.36	77.02 ± 0.32	0.003
			ChCI	—	120.06 ± 2.49	124.86 ± 0.59	0.024
I2-19 bp	STHS (ram)	98	ChCI	^b107.26 ± 2.48	^a113.71 ± 1.55	^a113.01 ± 1.07	1.122E-4
	TS (ram)	25	BBH(cm)	^a65.70 ± 1.24	^b62.82 ± 0.60	^a,b64.12 ± 0.51	0.044
			HL(cm)	—	21.45 ± 0.37	20.54 ± 0.19	0.029
	TS (ewe)	55	SH(cm)	^a63.00 ± 1.00	^b58.59 ± 0.58	^a,b60.54 ± 0.67	0.034
			TL(cm)	^a45.50 ± 4.50	^c29.46 ± 1.20	^c30.94 ± 0.89	0.001
I1-7 bp	STHS (ram)	98	ChWI	—	63.95 ± 2.11	68.94 ± 1.28	0.040
	TS (ram)	25	BL(cm)	—	67.88 ± 1.88	72.50 ± 0.85	0.034

Note: ChW, chest width; CaC, cannon circumference; CaCI, cannon circumference index; BLI, body length index; ChCI, chest circumference index; WL, wool length; ChC, chest circumference; BBH, body back height; HL, head length; SH, sacral height; TL, tail length; ChWI: chest width index; BL: body length. The values with different letters (a and b, or a and c) within the same row significantly at P < 0.05 and P < 0.01, respectively.