Chronic effects of maternal tobacco-smoke exposure and/or α-lipoic acid treatment on reproductive parameters in female rat offspring

Figures & data

Figure 1. Effects of maternal tobacco smoke and/or ALA treatment on pubertal maturation in female offspring. (A) Cumulative percentage of female rats showing vaginal opening according to age. In the tobacco-smoke group, significantly advanced vaginal opening compared to control female rats (p < 0.05). However, there was no significant difference in ALA or TS + ALA groups compared to the control group. (B) Pubertal weights of female offspring. There is a significant increase in pubertal weight belonging to the ALA group compared to control, TS and TS+ALA groups. There is no significant difference between TS, TS + ALA and control groups. Each experimental group consisted of 7 rats. Data are given as mean ± SD. * p < 0.001 (one-way ANOVA and post hoc Tukey test). VO: Vaginal opening, ALA: Alfa lipoic acid, TS: Tobacco smoke.

Table 1. Effects of TS and/or ALA on estrous cyclicity in female rats

	Control	TS	TS+ALA	ALA
Number of estrous cycles	2.4 ± 0.5	2 ± 1	2 ± 0.6	2.2 ± 0.8
Proestrus (day)	5 ± 0.8	4.3 ± 1.2	4.2 ± 0.6	4.4 ± 1.1
Estrus (day)	2.4 ± 0.5	2.6 ± 1	3.3 ± 1	2.8 ± 0.8
Metestrus (day)	2.8 ± 0.4	3.7 ± 1.6	2 ± 1.1	2.8 ± 2.5
Diestrus (day)	4.2 ± 1.3	4 ± 1.5	5.6 ± 1	4.4 ± 2.4

Values are given as mean ±standard deviation.

Data were presented as mean ± SD (one-way ANOVA and post hoc Tukey test, n = 7 for each group).

Figure 2. Effects of maternal tobacco smoke and/or ALA treatment on sexual motivation and receptivity in female offspring. (A) Frequency of anogenital investigations. (B) Lordosis quotient (lordoses/mounts x 100). (C) Lordosis quality scores. Each experimental group consisted of 7 rats. Data are given as mean ± SD. * p < 0.001 with control group (one-way ANOVA and post hoc Tukey test). ALA: Alfa lipoic acid, TS: Tobacco smoke.

Table 2. Effects of TS and/or ALA on LH, FSH (mlU/ml), TAS and TOS levels (pg/mL) in female rats (n= 7 for each group).

Groups	LH (mIU/mL)	FSH (mIU/mL)	TAS (pg/mL)	TOS (pg/mL)
Control	2.26 ± 0.22	2.47 ± 0.32	2.28 ± 0.14	11.40 ± 1.01
TS	2.7 ± 0.33^a	2.73 ± 0.39	1.59 ± 0.12^a	27.25 ± 3.20^a
TS+ALA	2.67 ± 0.24^a	2.53 ± 0.16	1.45 ± 0.14^a	29.07 ± 5.56^a
ALA	2.7 ± 0.32^a	2.67 ± 0.34	1.66 ± 0.25^a	26.53 ± 3.32^a

Values are given as mean ± standard deviation. ^aWhen compared to control group (p < 0.05).

Figure 3. Alteration of Apaf1, Casp 3 and Casp 9 mRNA expression levels in female offspring ovaries of tobacco smoke and/or ALA treatment. Compared to control group; Apaf1, Casp 3 and Casp 9 gene expressions significantly increased in TS, TS+ALA and ALA groups (p < 0.05). Each experimental group consisted of 7 rats. Data are given as mean ± SD. * p < 0.05 (one-way ANOVA and post hoc Tukey test). ALA: Alfa lipoic acid, TS: Tobacco smoke.

Table 3. The histopathological scores of ovaries

Groups	follicular degeneration	vascular congestion	germinal epithelial degeneration	inflammatory cell number	vacuolization in granulosa and luteal cells
Control	0.16 ± 0.4	0.16 ± 0.4	0.33 ± 0.51	0.16 ± 0.4	0.2 ± 0.54
TS	2.16 ± 0.4 ^a	2.16 ± 0.4 ^a	1.83 ± 0.75^a	2.16 ± 0.81 ^a	1.8 ± 0.64 ^a
TS +ALA	2.50 ± 0.54 ^a	2.33 ± 0.81 ^a	2.16 ± 0.7 ^a	2.33 ± 0.83 ^a	2.16 ± 0.4 ^a
ALA	2.0 ± 0.63 ^a	1.83 ± 0.75 ^a	1.66 ± 0.81^a	2.50 ± 0.75 ^a	2.0 ± 0.63 ^a

Values are given as mean ± standard deviation.^aWhen compared to control group (p < 0,05).

Figure 4. Photomicrographs of the effects of maternal tobacco smoke and/or ALA treatment on offspring ovary tissue: (A,E) control groups; normal ovarian tissue and some follicles; primary follicle (PF), secondary follicle (SF), Graafian follicle (GF), corpus luteum (CL) (B,F) (x20, x10 respectively) TS groups; ovarian tissue showing degenerated follicle (DF), vascular congestion (star), atretic follicle (AF), cystic follicle (CF) vacuolization in granulosa cells (black arrow) (C,G) (x20, x10 respectively) TS+ALA groups; ovarian tissue showing vacuolization in corpus luteum (black arrow), vascular congestion (star), degenerated follicle (DF) (D,H) (x20, x10 respectively) ALA groups; ovarian tissue showing germinal epithelial degeneration (arrowhead), decreased primordial follicle (thick arrow), increased inflammatory cell (triangle) (x20, x10 respectively) (Hematoxylin&Eosin).

Table 4. Effects of TS and/or ALA on ovarian follicle and corpus luteum count in female rats (n= 7 for each group).

Groups	Primordial Follicle	Primary Follicle	Secondary Follicle	Graafian Follicle	Corpus Luteum
Control	9.8 ± 1.9	6.8 ± 0.83	8.0 ± 1.58	3.6 ± 1.14	12.63 ± 1.14
TS	5.4 ± 1.14 ^a	3.0 ± 0.70 ^a	3.6 ± 1.14 ^a	1.4 ± 0,54 ^a	7.0 ± 0.83 ^a
TS+ALA	5.8 ± 0.83 ^a	2.6 ± 0.54 ^a	3.4 ± 0.54 ^a	1.2 ± 0.83^a	6.92 ± 1.12 ^a
ALA	6.2 ± 0.83 ^a	3.2 ± 0.44 ^a	4.0 ± 0.7 ^a	1.6 ± 0.64 ^a	7.2 ± 0.92 ^a

Values are given as mean ± standard deviation. ^aWhen compared to control group (p < 0,05).

Table 5. Apoptotic index (%), 8-OHdG and 4-HNE staining histoscores in groups

Groups	Apoptotic İndex (%)	8-OHdG	4-HNE
Control	2.8 ± 0.83	0.14 ± 0.08	0.22 ± 0.17
TS	19.68 ± 2.32 ^a	1.68 ± 0.69 ^a	1.74 ± 0.61 ^a
TS+ALA	22.24 ± 1.51 ^a	1.74 ± 0.61 ^a	1.86 ± 0.53^a
ALA	19.28 ± 2.16 ^a	1.38 ± 0.4 ^a	1.56 ± 0.32 ^a

Values are given as mean ± standard deviation. ^aWhen compared to control group (p < 0,05).

Figure 5. Arrows indicate TUNEL positive cells and 8-OHdG and 4-HNE immunoreactivities of the groups. Compared to control group, TUNEL positive cells, 8-OHdG and 4-HNE immunoreactivities significantly increased in TS, TS+ALA and ALA groups (p < 0.05). The areas stained in red indicated 8-OHdG or 4-HNE immunopositive staining. Also, brown nuclei indicated TUNEL positive cells. All slides were counterstained with hematoxylin (x20). TUNEL: Terminal deoxynucleotidyl transferase-mediated deoxyuridine-biotin nick end labeling, 8-OHdG: 8-hydroxydeoxyguanosine, 4-HNE: 4-Hidroxynonenal.

Table 6. Characteristics of the primers used for qPCR analysis

Primer Name	Primer sequence (5′ → 3′)		Accession ID	Reference
Gapdh	Forward	GACCCCTTCATTGACCTCAAC	DQ403053	(Grasselli et al. 2016)
	Reverse	CGCTCCTGGAAGATGGTGATGGG
Apaf1	Forward	GATATGGAATGTCTCAGATGGCC	XM_008765263.2	(Doğanlar et al. 2018)
	Reverse	GGTCTGTGAGGACTCCCCA
Casp3	Forward	TGCTTACTCTACCGCACCC	NM_012922.2	(Coccini et al. 2014)
	Reverse	CAACTACCTGATATCAAAGCTGAG
Casp9	Forward	GGCTGTCTACGGCACAGATGG	NM_031632	(Zhang et al. 2013)
	Reverse	CTGGCTCGGGGTTACTGCCAG

Grasselli E, Voci A, Demori I, Vecchione G, Compalati AD, Gallo G, Goglia F, De Matteis R, Silvestri E, Vergani L. 2016. Triglyceride mobilization from lipid droplets sustains the anti-steatotic action of iodothyronines in cultured rat hepatocytes. Front Physiol. 6:418. doi:https://doi.org/10.3389/fphys.2015.00418.

 PubMed Web of Science ®Google Scholar

Doğanlar ZB, Uzun M, Ovali MA, Dogan A, Ongoren G, Doğanlar O. 2018. Melatonin attenuates caspase-dependent apoptosis in the thoracic aorta by regulating element balance and oxidative stress in pinealectomised rats. Appl Physiol Nutr Metabol. 44(2):153–163.

 PubMed Web of Science ®Google Scholar

Coccini T, Gornati R, Rossi F, Signoretto E, Vanetti I, Bernardini G, Manzo L. 2014. Gene expression changes in rat liver and testes after lung instillation of a low dose of silver nanoparticles. J Nanomed Nanotechnol. 5(5):2–12.

 Google Scholar

Zhang JM, Wang HC, Wang HX, Ruan LH, Zhang YM, Li JT, Tian S, Zhang YC. 2013. Oxidative stress and activities of caspase-8, −9, and −3 are involved in cryopreservation-induced apoptosis in granulosa cells. Eur J Obstetrics Gynecology Reprod Biol. 166:52–55. doi:https://doi.org/10.1016/j.ejogrb.2012.09.011.

 PubMed Web of Science ®Google Scholar