MEX3A promotes angiogenesis in colorectal cancer via glycolysis

Figures & data

Table 1. Primer sequences for Qrt-PCR.

Gene	Primer sequence (5’→3’)
MEX3A	F: TGGAGAACTAGGATGTTTCGGG
	R: GAGGCAGAGTTGATCGAGAGC
MYC	F: CAAGAGGCGAACACACAACGTCT
	R: AACTGTTCTCGTCGTTTCCGCAA
HK2	F: TCTACCACATGCGCCTCTCT
	R: GCCCATTGTCCGTTACTTTC
PGK1	F: AGCGGGTCGTTATGAGAGTC
	R: CTCCAGCAGGATGACAGACC
β-actin	F: CTTAGTTGCGTTACACCCTTTCTTG
	R: CTGTCACCTTCACCGTTCCAGTTT

Figure 1. MEX3A expression is up-regulated in CRC.

Note: a: Bioinformatics analysis of MEX3A expression in CRC and normal tissues; b: MEX3A expression level in CRC Stage I+Stage II and Stage III+Stage IV stages; c: MEX3A expression in CRC M0 and M1 phases; d: MEX3A mRNA expression level in NCM-460, HCT116, SW480 and HT29 cells. * P < 0.05.

Figure 2. MEX3A promotes angiogenesis in CRC.

Note: a: GSEA showed that MEX3A was involved in the VEGF pathway; b: The mRNA expression level of MEX3A in HCT116 cells transfected with si-NC or si-MEX3A was measured by qRT-PCR; c: The protein expression level of MEX3A in HCT116 cells transfected with si-NC or si-MEX3A was measured by Western blot; d: CCK-8 assay was employed to evaluate the viability of HCT116 cells transfected with si-NC or si-MEX3A; e: Angiogenesis assay was applied to evaluate the angiogenesis ability of HUVECs; f: The protein levels of VEGF, FGF and SDF-1 in HUVECs were evaluated by Western blot. * P < 0.05.

Figure 3. MEX3A promotes glycolysis in CRC cells.

Note: a: MEX3A-enriched pathways shown by GSEA; b: qRT-PCR was applied to measure the expression levels of glycolytic metabolic genes in HCT116 cells transfected with si-NC or si-MEX3A; c: ECAR of HCT116 cells transfected with si-NC or si-MEX3A was evaluated by Seahorse XP, and the ECAR curves were generated with addition of glucose, oligomycin and 2-DG; d: OCR of HCT116 cells transfected with si-NC or si-MEX3A was measured by Seahorse XP, and the curves were generated with addition of oligomycin, FCCP and anti-mycin A; e-h: The levels of pyruvate, lactate, citric acid and malate in HCT116 cells transfected with si-NC or si-MEX3A were evaluated by corresponding kits. * P < 0.05.

Figure 4. MEX3A promotes CRC angiogenesis via glycolytic pathway activation.

Note: a: qRT-PCR was employed to analyze the effect of MEX3A and 2-DG on the mRNA expression of MEX3A in HCT116 cells; b: Western blot was employed to detect the effect of MEX3A and 2-DG on the protein expression of MEX3A in HCT116 cells; c: CCK-8 assay was performed to evaluate the viability of HCT116 cells treated with oe-NC+PBS, oe-MEX3A+PBS or oe-MEX3A+2-DG; d: Angiogenesis assay was conducted to evaluate the angiogenesis ability of HCT116 cells treated with oe-NC+PBS, oe-MEX3A+ PBS or oe-MEX3A+2-DG; e: The protein levels of VEGF, FGF and SDF-1 in HUVECs were measured by Western blot; f: The expression levels of specific genes related to glycolytic metabolic pathways (MYC, HK2, PGK1) in HCT116 cells treated with oe-NC+PBS, oe-MEX3A+ PBS or oe-MEX3A+2-DG were evaluated by qRT-PCR; G: The ECAR of HCT116 cells treated with oe-NC+PBS, oe-MEX3A+PBS or oe-MEX3A+2-DG was measured by Seahorse XP, and the ECAR curves were generated with addition of glucose, oligomycin and 2-DG; h: The OCR of HCT116 cells treated with oe-NC+PBS, oe-MEX3A+PBS or oe-MEX3A+2-DG was measured by Seahorse XP, and the curves were generated with addition of oligomycin, FCCP and anti-mycin A; i: The levels of pyruvate, lactate, citric acid and malate in HCT116 cells treated with oe-NC+PBS, oe-MEX3A+ PBS or oe-MEX3A+2-DG were detected by corresponding kits. * P < 0.05.

Data availability statement

The data used to support the findings of this study are available from the corresponding author upon request.