Assessing the impact of bacteriophages in the treatment of Salmonella in broiler chickens

Figures & data

Table 1. experimental design of bacteriophage treatments in (SPF) chicks challenged with S. typhimurium and S. enteritidis.

		Doses
Group	NO. of chicks	Bacteriophage	Salmonella	Treatment schedule of bacteriophage (days)	Age of Salmonella infection	Time of euthanasia (days)
Group (1)^a	30	–	–	–	–	5, 7, 9, 11, 14, 17
Group (2)^b	30	0.1ml 1.18 × 10^11PFU/chick	0.1ml 10^5 CFU/chick (S.T.)	1, 2, 3, 6, 8, 10, 13, 15	2nd day	5, 7, 9, 11, 14, 17
Group (3)^c	30	0.1 ml 1.03 × 10^12PFU/chick	0.1 ml 10^5 CFU/chick (S.E.)	1, 2, 3, 6, 8, 10, 13, 15	2nd day	5, 7, 9, 11, 14, 17
Group (4)^d	(A) 15	–	0.1ml 10^5 CFU/chick (S.T.)	–	2nd day	5, 7, 9, 11, 14, 17
	(B) 15	–	0.1ml 10^5 CFU/chick (S.E.)	–	2nd day	5, 7, 9, 11, 14, 17

^a group (1) control negative

^b group (2) bacteriophage treated and infected with S. Typhimurium

^c group (3) bacteriophage treated and infected with S. Enteritidis

^d group (4) control positive infected with S. Typhimurium (part A) and S. Enteritidis (part B).

Table 2. Oligonucleotide primers and probes used in this study.

Gene	Primer/probe sequence 5ʹ–3’	Reference
invA	GCGTTCTGAACCTTTGGTAATAA	Daum et al. (19)
	CGTTCGGGCAATTCGTTA
	5′-FAM-TGGCGGTGGGTTTTGTTGTCTTCT-TAMRA-3′

Figure 1. Plaque assay for bacteriophage enumeration.

Figure 2. (a) hemorrhagic patches in liver with distention of intestine with diarrhea (b) congestion of internal organs with pasting vent (c) enlargement and distention of the two ceci with diarrhea.

Table 3. Quantitative detection of S. typhimurium colonization in cecum of chicks under experiment.

Sample code	Group No.	Age of chicks	Results	Ct.	Conc. (CFU/gm)
T1	2	5 days	Positive	24.35	1.413 × 10^2
T2	2	5 days	Positive	23.38	2.778 × 10^2
T3	2	5 days	Positive	25.78	5.213 × 10^2
T4	2	5 days	Positive	22.95	3.749 × 10^2
T5	2	5 days	Positive	23.10	3.376 × 10^2
T6 (negative control)	1	5 days	Negative	No CT	–
T8 (positive control)	4 A	5 days	Positive	22.36	5.656 × 10^2
T9	2	7 days	Positive	23.62	2.350 × 10^2
T10	2	7 days	Negative	No CT	–
T11	2	7 days	Negative	No CT	–
T12	2	7 days	Positive	22.85	4.019 × 10^2
T13	2	7 days	Negative	No CT	–
T14(negative control)	1	7 days	Negative	No CT	–
T16(positive control)	4A	7 days	Positive	21.70	8.960 × 10^2
T17	2	9 days	Negative	No CT	–
T18	2	9 days	Negative	No CT	–
T19	2	9 days	Negative	No CT	–
T20	2	9 days	Negative	No CT	–
T21	2	9 days	Negative	No CT	–
T22(negative control)	1	9 days	Negative	No CT	–
T24(positive control)	4A	9 days	Positive	20.45	2.142 × 10^3
T25	2	11 days	Negative	No CT	–
T26	2	11 days	Negative	No CT	–
T27	2	11 days	Negative	No CT	–
T28	2	11 days	Negative	No CT	–
T29	2	11 days	Negative	No CT	–
T30(negative control)	1	11 days	Negative	No CT	–
T32(positive control)	4A	11 days	Positive	20.63	1.889 × 10^3
T33	2	14 days	Negative	No CT	–
T34	2	14 days	Negative	No CT	–
T35	2	14 days	Negative	No CT	–
T36	2	14 days	Negative	No CT	–
T37	2	14 days	Negative	No CT	–
T38(negative control)	1	14 days	Negative	No CT	–
T40(positive control)	4A	14 days	Positive	19.84	3.277 × 10^3
T41	2	17 days	Negative	No CT	–
T42	2	17 days	Negative	No CT	–
T43	2	17 days	Negative	No CT	–
T44	2	17 days	Negative	No CT	–
T45	2	17 days	Negative	No CT	–
T46(negative control)	1	17 days	Negative	No CT	–
T48(positive control)	4A	17 days	Positive	19.20	5.119 × 10^3

T: Typhimurium Ct: cycle threshold conc.: concentration.

Table 4. Quantitative detection of S. enteritidis colonization in cecum of chicks under experiment.

Sample code	Group No.	Age of chicks	Results	Ct.	Conc. (CFU/gm)
E1	3	5 days	Positive	22.49	7.415 × 10^3
E2	3	5 days	Positive	23.81	2.999 × 10^3
E3	3	5 days	Positive	24.20	2.296 × 10^3
E4	3	5 days	Positive	24.57	1.781 × 10^3
E5	3	5 days	Positive	22.01	1.030 × 10^4
E6 (negative control)	1	5 days	Negative	No CT	–
E8 (positive control)	4B	5 days	Positive	22.86	5.753 × 10^3
E9	3	7 days	Positive	21.45	1.513 × 10^4
E10	3	7 days	Negative	No CT	–
E11	3	7 days	Positive	20.86	2.267 × 10^4
E12	3	7 days	Negative	No CT	–
E13	3	7 days	Negative	No CT	–
E14(negative control)	1	7 days	Negative	No CT	–
E16 (positive control)	4B	7 days	Positive	22.05	1.003 × 10^4
E17	3	9 days	Negative	No CT	–
E18	3	9 days	Negative	No CT	–
E19	3	9 days	Negative	No CT	–
E20	3	9 days	Negative	No CT	–
E21	3	9 days	Negative	No CT	–
E22(negative control)	1	9 days	Negative	No CT	-
E24(positive control)	4B	9 days	Positive	21.32	1.654 × 10^4
E25	3	11 days	Negative	No CT	–
E26	3	11 days	Negative	No CT	–
E27	3	11 days	Negative	No CT	–
E28	3	11 days	Negative	No CT	–
E29	3	11 days	Negative	No CT	–
E30(negative control)	1	11 days	Negative	No CT	–
E32(positive control)	4B	11 days	Positive	20.74	2.461 × 10^4
E33	3	14 days	Negative	No CT	–
E34	3	14 days	Negative	No CT	–
E35	3	14 days	Negative	No CT	–
E36	3	14 days	Negative	No CT	–
E37	3	14 days	Negative	No CT	–
E38(negative control)	1	14 days	Negative	No CT	–
E40(positive control)	4B	14 days	Positive	20.15	3.689 × 10^4
E41	3	17 days	Negative	No CT	–
E42	3	17 days	Negative	No CT	–
E43	3	17 days	Negative	No CT	–
E44	3	17 days	Negative	No CT	–
E45	3	17 days	Negative	No CT	–
E46(negative control)	1	17 days	Negative	No CT	–
E48(positive control)	4B	17 days	Positive	18.21	1.395 × 10^5

E: Enteritidis Ct: cycle threshold conc.: concentration.

Daum LT, Barnes WJ, McAvin JC, Neidert MS, Cooper LAHuff WB, Lohman kl. Real-time Pcr Detection Of Salmonella in Suspect Foods from a Gastroenteritis Outbreak in Kerr County, Texas. J Clin Microbiol. 2002;40(8):3050-3052.

 Google Scholar