Molecular determination of genetic diversity among Campylobacter jejuni and Campylobacter coli isolated from milk, water, and meat samples using enterobacterial repetitive intergenic consensus PCR (ERIC-PCR)

Figures & data

Table 1. Primers sets used for the identification of Campylobacter species.

Target strain	Primer sets	Base pairs	Targeted genes	PCR condition	Cycles	Reference
Genus Campylobacter	F: GGTGTAGGATGAGACTATATA R: TTCCATCTGCCTCTCCC	439 bp	16S rRNA	95°C for 5 min, followed by 94°C for I min, 58°C for 1 min, 72°C for 2 min, and the final extension was set at 72°C for 2 min.	33	[30]
C. coli	F: GCTTCGCATAGCTAACAT R: GGTATGATTTCTACAAAGCGAG	502 bp	asK	95°C for 15 min, 95°C for 30 sec, 50°C for 90 min, 72°C for I min and 72°C for 7 min.	25	[31]
C. jejuni	F: CAAATAAAGTTAGAGGTAGAATGT R: CCATAAGCACTAGCTAGCTGAT	161 bp	cj0414	95°C for 15 min, 95°C for 30 sec, 50°C for 90 min, 72°C for I min and 72°C for 7 min	25	[31]

Figure 1. A gel image of PCR confirmed C. jejuni. Lane M: 100 bp DNA ladder, lane 1: positive control (C. jejuni ATCC 33560), lane 2: negative control, lane 3–6: positive C. jejuni isolates (161 bp) while image B are some confirmed C. coli. Lane 1: positive control (C. coli ATCC 33559), lane 2: negative control, lane 3–8: positive C. coli isolates (502 bp).

Figure 2. Gel ERIC-PCR amplification results of C. jejuni isolates. M, DNA ladder, 1–18: some amplified C. jejuni isolates.

Figure 3. UPGMA dendrogram image obtained from cluster analysis showing the relationship and diversity of 36 C. jejuni isolates from different sources using ERIC-PCR technique.

Figure 4. Gel ERIC-PCR amplification results of C. coli isolates. M, DNA ladder, 1–18: some amplified C. coli isolates.

Figure 5. UPGMA dendrogram image obtained from cluster analysis showing the relationship and diversity of 35 C. coli isolates from different sources using ERIC-PCR technique.

Moreno Y , Botella S , Luis Alonso J , et al. Specific detection of Arcobacter and Campylobacter strains in water and sewage by PCR and fluorescent in situ hybridization. Appl Environ Microbiol. 2003;69(2):1181–1186.

 Web of Science ®Google Scholar

Yamazaki-Matsune W , Taguchi M , Seto K , et al. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis . J Medical Microbiol. 2007;56(11):1467–1473.

 Web of Science ®Google Scholar