Detection of Helicobacter pylori oipA and dupA genes among dyspeptic patients with chronic gastritis

Figures & data

Table 1. Primers’ sequences, PCR conditions, and amplicon sizes for detection of target genes.

Genes	Primers	Primers’ sequence	PCR conditions	Amplicon size
ureC	ureC-F ureC-R	AAGCTTTTAGGGGTGTTAGGGGTTT AAGCTTATTTCTAACGC	35 cycles at 39°C for 1 min, 55°C for 1 min, and 72°C for 1 min	295 bp
cagA	cagA-F cagA-R	AGAGCAAGCGTTAGCCGATCTCAA TTTCCCTACACCACCCAAACCACT	Initial denaturation at 95°C, for 3 min followed by 45 cycles of: Denaturation at 95°C, for 45 sec Annealing at 60°C, for 45 sec Extension at 72°C, for 2 min	415 bp
dupA	dupA-F dupA-R	TGAGCGTGGTAGCTCTTGAC GAGCGCGTTAGCGATATAGG		584 bp
oipA	oipA-F oipA-R	GTTTTTGATGCATGGGATTT GTGCATCTCTTATGGCTTT		401 bp

Table 2. Relation between studied virulence genes and histopathological intensity of gastritis among cases.

		Intensity of gastritis			P	Sig
		Mild (22 cases)	Moderate (13 cases)	Severe (5 cases)
		N (%)	N (%)	N (%)
cagA	Negative	22 (100%)	11 (84.6%)	1 (20%)	0.001*	HS
	Positive	0 (0%)	2 (15.4%)	4 (80%)
oipA	Negative	22 (100%)	5 (38.5%)	0 (0%)	0.001*	HS
	Positive	0 (0%)	8 (61.5%)	5 (100%)
dupA	Negative	19 (86.4%)	10 (76.9%)	2 (40%)	0.108*	NS
	Positive	3 (13.6%)	3 (23.1%)	3 (60%)

*Fisher’s exact test, HS = highly significant, NS = non-significant.

Table 3. Relation between studied genes and gastroduodenitis among cases.

		Gastroduodenitis (8 cases)		P	Sig
		Negative	Positive
		N (%)	N (%)
cagA	Negative	29 (90.6%)	5 (62.5%)	0.082*	NS
	Positive	3 (9.4%)	3 (37.5%)
oipA	Negative	25 (78.1%)	2 (25%)	0.008*	HS
	Positive	7 (21.9%)	6 (75%)
dupA	Negative	25 (78.1%)	6 (75%)	1.0*	NS
	Positive	7 (21.9%)	2 (25%)

*Fisher’s exact test

Figure 1. PCR products for H. pylori with cagA gene-based primers. Lanes 2–4 and 23, 25 and 35 are patients’ positive biopsy samples. Lanes Pc & W are positive (strain D0008) & negative (sterile distilled water) control, respectively.

Figure 2. PCR products for H. pylori with oipA gene-based primers. Lanes 1–4 and 23, 25–26, 31–32, 34–35 and 38–39 are patients’ positive biopsy samples. Lanes Pc & W are positive (strain D0008) & negative (sterile distilled water) control, respectively.

Figure 3. PCR products for H. pylori with dupA gene-based primers. Lanes 1–4 and 15, 20 and 24–26 are patients’ positive biopsy samples. Lanes Pc & W are positive (strain D0008) & negative (sterile distilled water) control, respectively.

Table 4. Association between cagA, oipA, and dupA genes among cases.

		cagA				KAPPA	p (Sig)
		Negative		Positive
		N	%	N	%
dupA	Negative	28	82.4%	3	50.0%	0.268	0.115 (NS)
	Positive	6	17.6%	3	50.0%
oipA	Negative	27	79.4%	0	0%	0.536	0.001(HS)
	Positive	7	20.6%	6	100%
		oipA
		Negative		Positive
dupA	Negative	22	81.5%	9	69.2%	0.133	0.437 (NS)
	Positive	5	18.5%	4	30.8%

*Kappa statistics