Diagnostic and prognostic impact of E6/E7 mRNA compared to HPV DNA and p16 expression in head and neck cancers: an Egyptian study

Figures & data

Table 1. The primer sequences used for HPV16 E6/7 mRNA detection [15].

Target genes	Primer	Sequence (5′-3′)
HPV-16 E6	Forward	CTGCAATGTTTCAGGACCCA
	Reverse	TCATGTATAGTTGTTTGCAGCTCTGT
HPV-16 E7	Forward	AAGTGTGACTCTACGCTTCGGTT
	Reverse	GCCCATTAACAGGTCTTCCAAA

Figure 1. Melting curve of E6.

Figure 2. Melting curve of E7.

Figure 3. Sites of SCC in the studied patients.

Figure 4. Distribution of tumor stages in the studied cases.

Table 2. Correlation between HPV16 DNA and clinicopathologic variables of the studied patients.

Clinicopathologic variables		HPV DNA				P -value
		Positive (n = 27)		Negative (n = 24)
		Count	%	Count	%
Sex	Female	4	14.8%	4	16.7%	1
	Male	23	85.2%	20	83.3%
Site	Larynx	19	70.4%	18	75.0%	0.188
	Tongue	1	3.7%	3	12.5%
	Oropharynx	6	22.2%	1	4.2%
	Nasopharynx	0	0.0%	1	4.2%
	Hypopharynx	1	3.7%	1	4.2%
Smoking	Yes	17	63.0%	19	79.2%	0.205
	No	10	37.0%	5	20.8%
Alcohol	Yes	1	3.7%	1	4.2%	1
	No	26	96.3%	23	95.8%
Grade	GII	24	88.9%	16	66.7%	0.054
	GIII	3	11.1%	8	33.3%
Stage	Stage I	6	22.2%	5	20.8%	0.714
	Stage II	9	33.3%	8	33.3%
	Stage III	7	25.9%	3	12.5%
	Stage IVA	4	14.8%	6	25.0%
	Stage IVB	1	3.7%	2	8.3%
Tumor stage(T)	Tx	1	3.7%	0	0%	0.646
	T1	6	22.2%	4	16.7%
	T2	9	33.3%	8	33.3%
	T3	8	29.6%	5	20.8%
	T4a	3	11.1%	4	16.7%
	T4b	0	0%	2	8.3%
	Tis	0	0%	1	4.2%
N stage	N0	22	81.5%	16	66.7%	0.388
	N1	2	7.4%	4	16.7%
	N2	2	7.4%	4	16.7%
	N3	1	3.7%	0	0%

Tx: Primary tumor cannot be assessed; Tis: Carcinoma in-situ.

Table 3. Correlation between E6/E7 mRNA and clinicopathologic variables of the studied patients.

Clinicopathologic variables		E6/E7 mRNA				P- value
		Positive (n = 27)		Negative (n = 24)
		Count	%	Count	%
Sex	Female	4	14.8%	4	16.7%	1
	Male	23	85.2%	20	83.3%
Site	Larynx	19	70.4%	18	75.0%	0.007
	Tongue	1	3.7%	3	12.5%
	Oropharynx	7	25.9%	0	0%
	Nasopharynx	0	0%	1	4.2%
	Hypopharynx	0	0%	2	8.3%
Smoking	Yes	16	59.3%	20	83.3%	0.060
	No	11	40.7%	4	16.7%
Alcohol	Yes	1	3.7%	1	4.2%	1
	No	26	96.3%	23	95.8%
Grade	GII	24	88.9%	16	66.7%	0.054
	GIII	3	11.1%	8	33.3%
Stage	Stage I	5	18.5%	6	25.0%	0.299
	Stage II	11	40.7%	6	25.0%
	Stage III	7	25.9%	3	12.5%
	Stage IVA	3	11.1%	7	29.2%
	Stage IVB	1	3.7%	2	8.3%
Tumor stage(T)	Tx	1	3.7%	0	0.0%	0.302
	T1	5	18.5%	5	20.8%
	T2	11	40.7%	6	25.0%
	T3	8	29.6%	5	20.8%
	T4a	2	7.4%	5	20.8%
	T4b	0	0.0%	2	8.3%
	Tis	0	0.0%	1	4.2%
N stage	N0	22	81.5%	16	66.7%	0.388
	N1	2	7.4%	4	16.7%
	N2	2	7.4%	4	16.7%
	N3	1	3.7%	0	0%

Tx: Primary tumor cannot be assessed; Tis: Carcinoma in-situ.

Figure 5. A: Photomicrograph showing moderately differentiated non-keratinized squamous cell carcinoma [H&E, magnification x200], B: Photomicrograph showing negative staining of p16 of the same case [p16-INK4a, original magnification x200].

Figure 6. A: Photomicrograph showing moderately differentiated keratinized squamous cell carcinoma [H&E, original magnification x400], B: Photomicrograph showing positive cytoplasmic p16 staining via IHC of the same case [p16-INK4a, magnification x400].

Table 4. Correlations between p16 and clinicopathologic variables of the studied patients.

Clinicopathologic variables		p16 IHC				P- value
		Positive (n = 25)		Negative (n = 26)
		Count	%	Count	%
Sex	Female	3	12.00%	5	19.20%	0.703
	Male	22	88.00%	21	80.80%
Site	Larynx	18	72.00%	19	73.10%	0.571
	Tongue	1	4.00%	3	11.50%
	Oropharynx	5	20.00%	2	7.70%
	Nasopharynx	0	0%	1	3.80%
	Hypopharynx	1	4.00%	1	3.80%
Smoking	Yes	16	64.00%	20	76.90%	0.311
	No	9	36.00%	6	23.10%
Alcohol	Yes	0	0.00%	2	7.70%	0.49
	No	25	100.00%	24	92.30%
Grade	GII	23	92.00%	17	65.40%	0.021
	GIII	2	8.00%	9	34.60%
Stage	Stage I	4	16.00%	7	26.90%	0.769
	Stage II	10	40.00%	7	26.90%
	Stage III	5	20.00%	5	19.20%
	Stage IVA	5	20.00%	5	19.20%
	Stage IVB	1	4.00%	2	7.70%
Tumor stage(T)	Tx	1	4.00%	0	0%	0.65
	T1	4	16.00%	6	23.10%
	T2	10	40.00%	7	26.90%
	T3	6	24.00%	7	26.90%
	T4a	4	16.00%	3	11.50%
	T4b	0	0%	2	7.70%
	Tis	0	0%	1	3.80%
N stage	N0	19	76.00%	19	73.10%	0.889
	N1	3	12.00%	3	11.50%
	N2	2	8.00%	4	15.40%
	N3	1	4.00%	0	0%

Tx: Primary tumor cannot be assessed; Tis: Carcinoma in-situ.

Wang‐Johanning F, Lu DW, Wang Y, et al. Quantitation of human papillomavirus 16 E6 and E7 DNA and RNA in residual material from Thin Prep Papanicolaou tests using real‐time polymerase chain reaction analysis. Cancer. 2002;94(8):2199–2210.

 Web of Science ®Google Scholar

Data availability

All datasets generated or analyzed during this study are included in the manuscript.