Isolation and identification of a phosphate solubilising fungus from soil of a phosphate mine in Chaluse, Iran

Figures & data

Table 1. Species-specific PCR primers for amplification of partial sequence of the calmodulin gene in A. niger or A. tubingensis.

Region	Name	Sequence (5′–>3′)	Reference
Calmodulin	NIG1 (Forward)	TCCGTAGGTGAACCTGCGG	Susca et al. (2007)
Calmodulin	NIG2 (Reverse)	GCTGCGTTCTTCATCGATGC
Calmodulin	TUB1 (Forward)	GCATCGATGAAGAACGCAGC
Calmodulin	TUB2 (Reverse)	TCCTCCGCTTATTGATATGC

Figure 1. Variations of culture pH at various RP concentrations during incubation period. Vertical bars denote standard deviation, n = 3.

Figure 2. Phosphatase production at various RP concentrations during incubation period. Vertical bars denote standard deviation, n = 3.

Table 2. Organic acid production by A. tubingensis SANRU at various RP concentration on day 9 of incubation time.

RP concentration	Citric acid (mM)	Oxalic acid (mM)
1	*19.4 A	10.27 A
2	12.36 B	4.1 B
3	7.5 C	1.26 C
4	3.4 D	0 C

RP: Rock phosphate.

*Values are means of three replicates. Means values within a column followed by the same letter are not significantly different (p < 0.05) based on Tukey’s test.

Figure 3. Solubilisation of P by A. tubingensis SANRU at various RP concentrations during incubation period. Vertical bars denote standard deviation, n = 3. Means with different letters are significantly different from each other (p < 0.05) according to the Tukey’s test.

Table 3. Comparison of P solubilisation from rock phosphate in the present study and with those obtained in the literatures.

Fungal strain	Solubilised P (mg/l)	References
Aspergillus tubingensis SANRU	347.07	Present study
Aspergillus niger	382	Schneider et al. (2010)
Aspergillus niger	306	Schneider et al. (2010)
Aspergillus niger	281	Schneider et al. (2010)
Aspergillus tubingensis	277	Achal et al. (2007)
Aspergillus niger	147	Mendes et al. (2014)
Aspergillus niger	127	Mendes et al. (2014)
Aspergillus awamori S19	81	Jain et al. (2012)

Figure 4. Relationship between pH (a), organic acid (b) and acid phosphatase (c) of bacterial culture and solubilised P. Each value represents the mean of three replicates with standard deviation shown by error bars.

Figure 5. XRD diffractogram of RP of control (a) and solubilised by A. tubingensis SANRU (b), respectively, at the incubation period. Letter designations: A, apatite; C, calcite; H, haematite; D, dolomite; M, magnetite; Q, quartz.

Table 4. XRF elemental analysis of RP before and after bio-solubilisation.

Composition	wt%		Composition	wt%
	Before	After		Before	After
P2O5	10.7	7.1	Al2O3	1.3	2.7
Na2O	0.5	0.06	K2O	0.28	1.6
TiO2	0.73	0.72	SiO2	24.4	24.3
MgO	1.4	1.2	CaO	21.5	13.0
Cl	0.25	0.21	LOI^§	7.34	21.0
Fe2O3 + FeO	30.7	26.8

RP: Rock phosphate; XRF: X-ray fluorescence.

^§Loss on ignition.

Susca A, Stea S, Mule G, Perrone G. 2007. Polymerase chain reaction (PCR) identification of Aspergillus niger and Aspergillus tubingensis based on the calmodulin gene. Food Addit Contam. 24:1154–116.

 PubMed Web of Science ®Google Scholar

Schneider KD, van Straaten P, de Orduna RM, Glasauer S, Trevors J, Fallow D, Smith PS. 2010. Comparing phosphorus mobilization strategies using Aspergillus niger for the mineral dissolution of three phosphate rocks. J Appl Microbiol. 108:366–374.

 PubMed Web of Science ®Google Scholar

Achal V, Savant VV, Sudhakara Reddy M. 2007. Phosphate solubilization by wild type strain and UV-induced mutants of Aspergillus tubingensis. Soil Biol Biochem. 39:695–699.

 Web of Science ®Google Scholar

Mendes GO, de Freitas AML, Pereira OL, da Silva IR, Vassilev NB, Costa MD. 2014. Mechanisms of phosphate solubilization by fungal isolates when exposed to different P sources. Ann Microbiol. 64:239–249.

 Web of Science ®Google Scholar

Jain R, Saxena J, Sharma V. 2012. Solubilization of inorganic phosphates by Aspergillus awamori S19 isolated from rhizosphere soil of a semi-arid region. Ann Microbiol. 62:725–735.

 Web of Science ®Google Scholar