Primer pairs, PCR conditions, and peptide nucleic acid clamps affect fungal diversity assessment from plant root tissues

Figures & data

Table 1. Amplicon size, fungal specificity, and the sequences of primers used.

Primers	Specificity for fungi	Sequences (5’–3’)	References
fIT7	98%	GTGARTCATCGAATCTTTG	Ihrmark et al. (2012)
gITS7	99%	GTGARTCATCGARTCTTTG	Ihrmark et al. (2012)
ITS4	98%	TCCTCCGCTTATTGATATGC	White et al. (1990))
Amplicons size (bp): 292
5.8S-Fun	95%	AACTTTYRRCAAYGGATCWCT	Taylor et al. (2016)
ITS4-Fun	90%	AGCCTCCGCTTATTGATATGCTTAART	Taylor et al. (2016)
Amplicons size (bp): 440
PNA	-	CGAGGGCACGTCTGCCTGG	Cregger et al. (2018)

Figure 1. Variation in the SynMock community composition depending on the primer pair used (fITS7/ITS4 in red; gITS7/ITS4 in green and 5.8S-Fun/ITS4-fun in blue), the addition of PNA clamps (+PNA) and the ratio of plant-mock DNA (50:50 or 80:20). (a) OTU Bray-Curtis dissimilarity between classic amplification (T_a = 57 °C) and the various conditions tested. (b) Relative abundance of the 12 OTUs composing the SynMock.

Table 2. Mean number of fungal sequences (±SE) obtained using the SynMock community for the three primer pairs (T_a = 57 °C) and the various combined treatments tested.

Primer pairs	Ta  = 57 °C	+PNA	50:50 plant-mock	50:50 +PNA	80:20 plant-mock	80:20 +PNA
fITS7/ITS4	246,913 ± 11,955^a	218,033 ± 17,439^ab	236,290 ± 6,130^ab	229,954 ± 14,493^ab	204,413 ± 7,241^ab	228,534 ± 42,884^ab
gITS7/ITS4	205,999 ± 19,578^ab	231,118 ± 6,776^ab	242,530 ± 3,204^ab	189,718 ± 3,601^ab	217,261 ± 9,906^ab	223,649 ± 14,853^ab
5.8S-Fun/ITS4-Fun	169,416 ± 10,723^ab	176,245 ± 13,371^ab	204,221 ± 2,730^ab	164,275 ± 16,281^ab	200,470 ± 7,536^ab	185,277 ± 10,225^b

Different letters indicate significant differences between primer pairs and the tested conditions using a Kruskal-Wallis analysis followed by a post-hoc test using Fisher’s least significant difference, P < 0.05.

Figure 2. Abundance, richness and diversity of fungi in Urtica dioica roots for the three primer pairs tested fITS7/ITS4, gITS7/ITS4, and 5.8S-Fun/ITS4-fun (T_a = 57 °C), the addition of PNA clamps (+PNA) and the increase of T_a (T_a = 68 °C or 63 °C). (a–c) Relative abundance of reads of Viridiplantae, fungi, and other phyla (i.e. Amoebozoa, Choanoflagellozoa, Heterolobosa, Ichthyosporia, Metazoa, Protista, Rhizaria, rhodoplantae, Stramenopila, and NA); (d–f) Richness and (g–i) Shannon’s index. Boxes with the same letters did not differ significantly from each other using a Tukey-adjusted comparison and Kruskal-Wallis analysis followed by a post-hoc test using Fisher’s least significant difference, respectively, P < 0.05.

Figure 3. Percentage reduction in the number of OTUs for each primer pairs (fITS7/ITS4, gITS7/ITS4, and 5.8S-Fun/ITS4-fun) compared to the number of OTUs obtained with 5.8S-Fun, subsampled at various sequencing depths.

Figure 4. Fungal community composition in Urtica dioica roots depending on the primer pair used fITS7/ITS4, gITS7/ITS4, and 5.8S-Fun/ITS4-fun (T_a = 57 °C), the addition of PNA clamps (+PNA) and a higher T_a (T_a = 68 °C or 63 °C). (a) Non-metric multidimensional scaling (NMDS) analysis of the fungal communities, based on OTUs composition; (b) Relative abundance and F-value from linear mixed-effect models measuring the effect of primers, T_a, PNA, the number of OTUs and the number of reads on the relative abundances of fungal classes and (c) Genera.

Figure 5. Representative classes and phyla of (a) non-specific or (b–c) specific OTUs of fungal community in Urtica dioica roots according to primer pairs (fITS7/ITS4, gITS7/ITS4, and 5.8S-Fun/ITS4-fun) and conditions used, as well as the number of OTUs corresponding. “Common” corresponds to the OTUs that were found in all PCR conditions with the three primer pairs. “Non-specific” corresponds to the OTUs that were found in at least one condition (T_a = 57 °C; +PNA or T_a = 68–63 °C) of PCR with the three primer pairs.

Figure 6. (a) Relative abundance of specific and non-specific OTUs for each primer pair used (fITS7/ITS4: red; gITS7/ITS4: green; 5.8S-Fun/ITS4-fun: blue), with the addition of PNA clamps (+PNA) and a higher annealing temperature (T_a = 68 °C or 63 °C); (b) OTU Bray-Curtis dissimilarity between the different primer pairs (T_a = 57 °C), with or without PNA clamps (+PNA), or with an annealing temperature of 68 °C or 63 °C.

Figure 7. Number of OTUs found in at least two replicates, either without or with the addition of PNA clamps (+PNA), mean relative abundance in percentage ±SE for each primer pair (fITS7/ITS4, gITS7/ITS4, and 5.8S-Fun/ITS4-fun) and the percentage of represented fungal classes.

Ihrmark K, Bödeker ITM, Cruz-Martinez K, Friberg H, Kubartova A, Schenck J, Strid Y, Stenlid J, Brandström-Durling M, Clemmensen KE, et al. 2012. New primers to amplify the fungal ITS2 region – Evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol Ecol. 82(3):666–677. doi:10.1111/j.1574-6941.2012.01437.x.

 PubMed Web of Science ®Google Scholar

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications. New York (NY): Academic Press Inc; pp. 315–322.

 Google Scholar

Taylor DL, Walters WA, Lennon NJ, Bochicchio J, Krohn A, Caporaso JG, Pennanen T, Cullen D. 2016. Accurate estimation of fungal diversity and abundance through improved lineage-specific primers optimized for illumina amplicon sequencing. Appl Environ Microbiol. 82(24):7217–7226. doi:10.1128/AEM.02576-16.

 PubMed Web of Science ®Google Scholar

Cregger MA, Veach AM, Yang ZK, Crouch MJ, Vilgalys R, Tuskan GA, Schadt CW. 2018. The populus holobiont: Dissecting the effects of plant niches and genotype on the microbiome. Microbiome. 6(1):31. doi:10.1186/s40168-018-0413-8.

 PubMedGoogle Scholar

Data availability statement

Raw sequence data for this project have been submitted to NCBI’s SRA archive under accession no. SUB12918264.