Voluntary wheel running improves adipose tissue immunometabolism in ovariectomized low-fit rats

Figures & data

Table 1. PCR primer sequences.

	5′–3′ primer sequence forward	5′–3′ primer sequence reverse
CD3	AGTAATGAGCCAGCCGTGTC	ATGCTCCAGAAAGCGTTCCA
CD8	CACTAGGCTCCAGGTTTCCG	CGCAGCACTTCGCATGTTAG
CD11c	CTGTCATCAGCAGCCACGA	ACTGTCCACACCGTTTCTCC
CD4	ACCCTAAGGTCTCTGACCCC	TAGGCTGTGCGTGGAGAAAG
TNFα	CCTCGGGCCAGTGTATGAGA	CCCAGAAAAGCAAGCAACCA
IL-6	AGAGACTTCCAGCCAGTTGC	AGCCTCCGACTTGTGAAGTG
F4/80	ATAGCGCAAGCTGTCTGGTT	GCCATAGCCACCTTCCTGTT
MCP1	CTGTCTCAGCCAGATGCAGTTAA	AGCCGACTCATTGGGATCAT
Adiponectin	CAAGGCCGTTCTCTTCACCT	CCCCATACACTTCGAGCCAG
Leptin	GACACCCTTAGAGGGGGCTA	ACCCCAAGCCCCTTTGTTCA
18s	GCCGCTAGAGGTGAAATTCTTG	CATTCTTGGCAAATGCTTTCG

Figure 1. Effects of OVX and wheel running on body composition in HCR and LCR rats. The data presented are summarized from previous findings.11, 23 (A) Body weight gain via (B) body fat % was examined in the (C) subcutaneous (SQAT), (D) total visceral depots (VAT) and (E) brown (BAT) depots. (F) relative BAT/VAT ratio. Calculations of (G) HOMA-IR and (H) Adipo-IR were completed to indirectly measure IR. *Indicates significant differences between ovary-intact (SHM) rats. Values are mean ± SEM (n = 5–10 per group); where p < 0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. NC = standard chow diet; HFD = high fat diet; SED = sedentary; VWR = voluntary wheel running.

Table 2. Final body weight and metabolic parameters.

	HCR			LCR
	SHM/SED	OVX/SED	OVX/VWR	SHM/SED	OVX/SED	OVX/VWR
Final body weight (g)	241.1 ± 8.4	304.9 ± 6.98^a	330.0 ± 6.6^a	286.1 ± 6.4^*	360.7 ± 11.3^a	327.5 ± 11.3^a
REE (kcal/day/kg)	123.6 ± 4.3	107.7 ± 1.9^a	116.3 ± 3.4	110.0 ± 3.3^*	89.0 ± 1.1^a	101.1 ± 2.6^a
TEE (kcal/day/kg)	169.0 ± 6.0	144.6 ± 3.2^a	153.1 ± 4.7^a	147.0 ± 3.8^*	116.9 ± 2.0^a	135.4 ± 3.9^a
SPA (x+y+z beam breaks)	32319 ± 2742	31312 ± 1716	27648 ± 1705	23319 ± 671^*	19671 ± 1507	21676 ± 2071

The data presented are summarized from previous findings [11, 23]. REE = resting energy expenditure; SED = sedentary; SHM = ovary-intact; SPA = spontaneous physical activity; TEE = total energy expenditure; VWR = voluntary wheel running.

* Significant difference between lines (HCR v LCR) within SHM condition.

^a Significant difference from SHM within line (HCR or LCR).

Data are presented as mean ± SEM; significance set at, p<0.05.

Figure 2. Effects of voluntary wheel running (VWR) on perigonadal WAT inflammation in OVX HCR and LCR rats. (A) % CD3 stromal vascular cells (SVCs), (B) % CD4 SVCs and (C) CD11c+ SVCs. Gene expression of inflammatory makers examined were (D) CD3, (E) CD4, and (F) CD11c (G) CD8, (H) TNFα, (I) IL-6, (J) F4/80, and (K) MCP1. *Indicates significant differences between ovary-intact (SHM) animals. Values are mean ± SEM (n=5–10 per group); where p < 0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. HFD = high fat diet; NC = standard normal chow; SED = sedentary.

Figure 3. Effects of voluntary wheel running (VWR) on subcutaneous WAT inflammation in OVX HCR and LCR rats. Pro-inflammatory and macrophage marker mRNA expression. (A) CD3, (B) CD4, (C) CD11c, (D) CD8, (E) TNFα, (F) IL-6, (G) F4/80, and (H) MCP1. *Indicates significant differences between these groups. Values are mean ± SEM (n = 5–10 per group); where p < 0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. HFD = high fat diet; NC = standard normal chow; SED = sedentary; SHM = ovary-intact.

Figure 4. Effects of voluntary wheel running (VWR) on interscapular BAT inflammation in OVX HCR and LCR rats. Pro-inflammatory and macrophage marker mRNA expression include (A) CD3, (B) CD4, (C) CD11c, (D) CD8, (E) TNFα, (F) IL-6, (G) F4/80, and (H) MCP1. *Indicates significant differences between ovary-intact (SHM) rats. Values are mean ± SEM (n=5–10 per group); where p < 0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. HFD = high fat diet; NC = standard normal chow; SED = sedentary.

Figure 5. Wheel running reduces circulating and tissue expression levels of leptin in LCR rats. Circulating (A) adiponectin and (B) leptin and the (C) adiponectin to leptin ratio. mRNA expression for adiponectin (D) in perigonadal (VAT), (E) subcutaneous (SQAT) WAT, and (F) BAT depots; and leptin (G) in VAT, (H) SQAT, and (I) BAT depots. *Indicates significant differences between these groups. Values are mean ± SEM (n=5–10 per group); where p<0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. BAT = brown adipose tissue; HFD = high fat diet; NC = standard normal chow; SED = sedentary; SHM = ovary-intact; VWR = voluntary wheel running.

Table 3. Pearson correlations for leptin in OVX LCR and HCR with and without running wheel.

	Serum leptin (ng/mL)	Corresponding fat depot
Visceral WAT leptin mRNA	0.60^**	0.53^**
Subcutaneous WAT leptin mRNA	0.79^***	0.69^***
BAT leptin mRNA	0.44^*	0.63^**

*** Correlation is significant when p < 0.001

** Correlation is significant when p < 0.01

* Correlation is significant when p < 0.05

Figure 6. Mitochondrial expression analyses across adipose tissue depots in HCR vs. LCR rats. Mitochondrial oxidative phosphorylation complexes I, II, III, IV, and V for (A-B) retroperitoneal WAT (VAT) and (D-E) BAT. Representative western blot images for (C) VAT and (F) BAT. *Indicates significant differences between ovary-intact (SHM) rats. Values are mean ± SEM; where p < 0.05 is statistically significant. L = line main effect, HCR vs. LCR; T = treatment main effect, SED vs. VWR; LxT = line by treatment interaction. BAT = brown AT; HFD = high fat diet; NC = standard normal chow; SED = sedentary; VWR = voluntary wheel running.

Table 4. Correlations for OVX LCR and HCR with and without running wheel.

	Visceral fat (g)	Total fat %	HOMA-IR	Adipo-IR
HOMA-IR	0.65^**	0.54^**		0.87^**
Adipo-IR	0.66^**	0.60^**	0.87^**
Serum adiponectin	0.34	0.38	0.06	0.11
Serum leptin	0.79^**	0.89^**	0.61^**	0.67^**
Adiponectin/leptin ratio	−0.75^**	−0.76^**	−0.59^**	−0.59^**
Visceral WAT Analyses
CD3+ T cells	0.51^*	0.68^**	−0.002	0.19
Adiponectin mRNA	0.37^*	0.32	0.47^*	0.52^**
Leptin mRNA	0.58^**	0.53^**	0.55^**	0.59^**
F4/80 mRNA	0.37^*	0.36^*	0.13	0.06
OxPhos complex III	0.39^*	0.38^*	0.02	0.22
Subcutaneous WAT Analyses
Leptin mRNA	0.70^**	0.80^**	0.29	0.33
BAT Analyses
Adiponectin mRNA	0.48^*	0.60^**	0.16	0.06
Leptin mRNA	0.58^**	0.59^**	0.40^*	0.28
OxPhos complex II	0.46^*	0.34	0.38^*	0.30

*** Correlation is significant when p < 0.001

** Correlation is significant when p < 0.01

* Correlation is significant when p < 0.05